Incidental Mutation 'R7313:Mki67'
ID567751
Institutional Source Beutler Lab
Gene Symbol Mki67
Ensembl Gene ENSMUSG00000031004
Gene Nameantigen identified by monoclonal antibody Ki 67
SynonymsD630048A14Rik, Ki-67, Ki67
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.856) question?
Stock #R7313 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location135689784-135716361 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 135694671 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glycine at position 2878 (A2878G)
Ref Sequence ENSEMBL: ENSMUSP00000033310 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033310]
Predicted Effect probably benign
Transcript: ENSMUST00000033310
AA Change: A2878G

PolyPhen 2 Score 0.287 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000033310
Gene: ENSMUSG00000031004
AA Change: A2878G

DomainStartEndE-ValueType
FHA 26 76 1.03e-11 SMART
Pfam:PP1_bind 462 519 2.8e-20 PFAM
low complexity region 535 545 N/A INTRINSIC
low complexity region 869 882 N/A INTRINSIC
Pfam:K167R 889 982 1.5e-9 PFAM
K167R 993 1102 2.01e-39 SMART
K167R 1107 1217 1.87e-57 SMART
K167R 1228 1337 1.33e-53 SMART
K167R 1348 1451 6.57e-44 SMART
K167R 1462 1570 9.09e-38 SMART
K167R 1580 1686 5.02e-40 SMART
K167R 1697 1807 9.6e-37 SMART
K167R 1818 1926 5.94e-51 SMART
K167R 1937 2047 1.6e-56 SMART
K167R 2058 2164 4.04e-53 SMART
K167R 2175 2285 1.52e-57 SMART
K167R 2296 2407 1.78e-40 SMART
K167R 2418 2527 1.71e-42 SMART
K167R 2538 2640 7.41e-20 SMART
K167R 2642 2750 1.06e-38 SMART
K167R 2761 2872 2.1e-42 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein that is associated with and may be necessary for cellular proliferation. Alternatively spliced transcript variants have been described. A related pseudogene exists on chromosome X. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice carrying a reporter allele show expression in actively dividing cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a A G 5: 8,723,187 N805S probably damaging Het
Acat2 A G 17: 12,960,006 V60A probably benign Het
Adam6b A G 12: 113,491,134 I524V probably benign Het
Adamts16 C T 13: 70,772,955 W590* probably null Het
Adamts9 C T 6: 92,858,121 G1257D probably damaging Het
Adgrf5 C T 17: 43,445,083 T644I probably benign Het
Adgrf5 T G 17: 43,452,477 probably null Het
Adgrv1 T C 13: 81,520,515 T2641A possibly damaging Het
Agap3 T C 5: 24,452,384 F60L probably benign Het
Akap9 C A 5: 4,004,933 T1626K probably damaging Het
Ampd3 C A 7: 110,806,054 D603E probably damaging Het
Angpt4 T A 2: 151,925,406 V119E probably benign Het
Atp6v1a T C 16: 44,114,617 T70A probably benign Het
B4galt3 T A 1: 171,272,749 I163N probably damaging Het
Borcs5 C T 6: 134,710,180 T167M probably damaging Het
Btbd19 T A 4: 117,121,419 S156C probably damaging Het
Camkk2 C T 5: 122,737,511 R492Q possibly damaging Het
Casr T C 16: 36,509,671 I434V probably damaging Het
Cd4 G T 6: 124,867,103 T394K probably benign Het
Cps1 T C 1: 67,198,358 L1006P probably damaging Het
Crx G A 7: 15,867,932 P274S probably damaging Het
Crybg1 T A 10: 43,989,111 I1457F probably damaging Het
Cul4a C A 8: 13,121,676 probably benign Het
D430041D05Rik T A 2: 104,255,565 T196S probably benign Het
Dnah3 T C 7: 119,981,344 E1995G probably benign Het
Dnm1 T A 2: 32,336,009 T353S probably damaging Het
E430018J23Rik C T 7: 127,391,684 S377N probably benign Het
Ect2l T A 10: 18,168,401 T329S probably damaging Het
Elp2 T A 18: 24,609,659 S83T probably benign Het
Exosc7 A G 9: 123,118,948 T39A probably benign Het
Fam135a C A 1: 24,057,392 V91F probably damaging Het
Gab2 G T 7: 97,081,798 probably benign Het
Gbf1 A T 19: 46,280,354 I1408F possibly damaging Het
Glis3 C T 19: 28,531,019 E522K probably damaging Het
Gm10375 A T 14: 43,604,857 C139S possibly damaging Het
Gm26558 T C 2: 70,661,867 E81G unknown Het
Gm35315 C T 5: 110,079,225 C116Y probably benign Het
Gm3676 T A 14: 41,644,107 I84F probably damaging Het
Gm7145 T A 1: 117,986,202 H271Q probably damaging Het
Gpat2 T A 2: 127,428,295 I76N probably damaging Het
Hipk1 A T 3: 103,778,258 S14T unknown Het
Hlcs C A 16: 94,267,503 S286I probably damaging Het
Ighg1 A T 12: 113,329,458 F204Y Het
Igsf10 T C 3: 59,329,416 I1115V probably benign Het
Klk7 A T 7: 43,812,875 H97L probably damaging Het
Kmt2d A T 15: 98,856,623 D1605E unknown Het
Leng8 T A 7: 4,139,526 I49N possibly damaging Het
Lingo4 A T 3: 94,403,144 D463V possibly damaging Het
Lrp1 T A 10: 127,553,468 N3193I probably damaging Het
Lrrc7 T A 3: 158,160,474 Y1210F probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Mucl2 C T 15: 103,899,179 probably null Het
Myh6 A T 14: 54,960,270 D470E probably benign Het
Myo1e T C 9: 70,359,385 probably null Het
Myo7a G A 7: 98,064,195 R1647W probably damaging Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nmral1 C T 16: 4,713,796 M198I probably benign Het
Nrap C A 19: 56,342,268 L1120F probably damaging Het
Nup155 T A 15: 8,154,922 I1267N probably damaging Het
Obscn G A 11: 59,007,588 P6616S unknown Het
Ocstamp T G 2: 165,397,309 D319A probably damaging Het
Olfr384 A T 11: 73,602,984 I135F probably damaging Het
Olfr600 A G 7: 103,346,331 V199A probably benign Het
Olfr787 T C 10: 129,462,987 S104P probably damaging Het
Olfr796 A G 10: 129,608,080 S134P probably benign Het
Olfr855 A G 9: 19,584,642 Y35C probably damaging Het
Ooep T C 9: 78,378,151 D61G probably damaging Het
Otoa A G 7: 121,102,542 E148G probably benign Het
Ovgp1 A T 3: 105,987,071 D720V unknown Het
Padi2 T A 4: 140,932,768 F294I probably damaging Het
Pcdha7 T A 18: 36,974,418 N165K probably damaging Het
Pcdhb6 C A 18: 37,335,208 P394H probably damaging Het
Pcdhga6 T C 18: 37,708,019 V264A possibly damaging Het
Pik3ap1 G T 19: 41,296,376 D623E possibly damaging Het
Prdm10 A T 9: 31,357,160 K802* probably null Het
Ptgfrn G A 3: 101,073,047 L326F possibly damaging Het
Rgsl1 T G 1: 153,807,876 probably null Het
Rock1 T G 18: 10,129,317 T347P possibly damaging Het
Rprd2 G A 3: 95,776,710 P338S probably damaging Het
Sdk1 A T 5: 141,937,622 N333Y probably damaging Het
Setd4 T A 16: 93,591,244 H118L probably benign Het
Sirt3 G A 7: 140,878,126 P37S Het
Slc16a9 G T 10: 70,283,170 G440W probably damaging Het
Slc22a23 T A 13: 34,183,178 I616F probably damaging Het
Slc30a8 A C 15: 52,317,311 D102A probably damaging Het
Slc6a4 T A 11: 77,010,701 D87E possibly damaging Het
Slc9a4 A C 1: 40,629,503 T769P probably benign Het
Soga3 T A 10: 29,196,879 Y722* probably null Het
Sspo A T 6: 48,454,828 Y685F probably damaging Het
Sspo C A 6: 48,473,456 Q2560K probably benign Het
Stpg1 T A 4: 135,529,516 L206Q probably damaging Het
Stt3b A T 9: 115,266,115 Y283N probably damaging Het
Sult4a1 T C 15: 84,086,613 E197G probably damaging Het
Syne1 T G 10: 5,047,635 D444A probably damaging Het
Tex15 T A 8: 33,574,817 V1425E possibly damaging Het
Tgm4 A G 9: 123,062,491 D557G probably benign Het
Tmcc3 A G 10: 94,430,572 probably benign Het
Tnfrsf8 T A 4: 145,274,382 N385Y probably benign Het
Ttc4 T C 4: 106,678,820 D15G possibly damaging Het
Tut1 A G 19: 8,964,049 N400S probably benign Het
Usp39 T C 6: 72,336,430 K259R probably benign Het
Vmn1r215 C T 13: 23,076,314 H175Y probably benign Het
Vmn1r36 A T 6: 66,716,123 M256K probably benign Het
Zfp128 T A 7: 12,890,534 H276Q possibly damaging Het
Zfp276 T C 8: 123,267,823 M543T probably damaging Het
Zfp354c A T 11: 50,814,656 Y531N probably damaging Het
Zfp532 T A 18: 65,623,005 M3K probably damaging Het
Zfp64 T G 2: 168,899,890 K373Q probably damaging Het
Zfp983 T G 17: 21,661,497 S114A probably damaging Het
Zranb1 G A 7: 132,982,752 R583K probably damaging Het
Other mutations in Mki67
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00225:Mki67 APN 7 135690120 missense probably benign 0.32
IGL00264:Mki67 APN 7 135707820 nonsense probably null
IGL00328:Mki67 APN 7 135696695 missense probably benign 0.03
IGL00570:Mki67 APN 7 135708101 missense possibly damaging 0.88
IGL00584:Mki67 APN 7 135695695 missense probably damaging 1.00
IGL00756:Mki67 APN 7 135698731 missense possibly damaging 0.76
IGL01063:Mki67 APN 7 135694922 missense possibly damaging 0.93
IGL01112:Mki67 APN 7 135714016 missense probably damaging 1.00
IGL01360:Mki67 APN 7 135705776 missense probably damaging 1.00
IGL01457:Mki67 APN 7 135699546 missense probably benign 0.00
IGL01686:Mki67 APN 7 135707813 missense probably benign 0.00
IGL01731:Mki67 APN 7 135696549 missense probably benign 0.03
IGL01775:Mki67 APN 7 135698276 missense possibly damaging 0.71
IGL01806:Mki67 APN 7 135698957 missense probably damaging 0.98
IGL01860:Mki67 APN 7 135698957 missense probably damaging 0.98
IGL01938:Mki67 APN 7 135694330 missense probably benign 0.04
IGL02249:Mki67 APN 7 135700522 missense possibly damaging 0.47
IGL02260:Mki67 APN 7 135701968 missense probably benign 0.00
IGL02270:Mki67 APN 7 135698632 missense probably damaging 1.00
IGL02406:Mki67 APN 7 135698793 missense probably benign 0.00
IGL02499:Mki67 APN 7 135694327 missense possibly damaging 0.94
IGL02655:Mki67 APN 7 135714019 missense probably damaging 0.98
IGL02700:Mki67 APN 7 135708202 missense probably benign 0.02
IGL03370:Mki67 APN 7 135695490 missense probably benign 0.00
PIT4468001:Mki67 UTSW 7 135699147 missense probably benign 0.00
R0001:Mki67 UTSW 7 135699172 missense probably damaging 1.00
R0001:Mki67 UTSW 7 135701019 missense probably damaging 0.99
R0043:Mki67 UTSW 7 135700581 missense probably benign 0.16
R0043:Mki67 UTSW 7 135700581 missense probably benign 0.16
R0102:Mki67 UTSW 7 135713803 missense probably benign 0.16
R0130:Mki67 UTSW 7 135696459 missense probably damaging 1.00
R0149:Mki67 UTSW 7 135698424 missense probably benign 0.00
R0356:Mki67 UTSW 7 135704406 missense probably benign 0.34
R0482:Mki67 UTSW 7 135699429 missense possibly damaging 0.60
R0508:Mki67 UTSW 7 135700346 missense probably benign
R0532:Mki67 UTSW 7 135698164 nonsense probably null
R0548:Mki67 UTSW 7 135695256 missense probably damaging 1.00
R0548:Mki67 UTSW 7 135696908 missense possibly damaging 0.82
R0557:Mki67 UTSW 7 135699261 missense possibly damaging 0.48
R0627:Mki67 UTSW 7 135708258 missense probably benign 0.31
R0631:Mki67 UTSW 7 135704388 missense probably damaging 0.98
R0848:Mki67 UTSW 7 135701043 missense probably benign 0.21
R1075:Mki67 UTSW 7 135697311 missense probably benign 0.03
R1105:Mki67 UTSW 7 135701050 missense probably benign 0.09
R1272:Mki67 UTSW 7 135700414 nonsense probably null
R1331:Mki67 UTSW 7 135698276 missense possibly damaging 0.71
R1486:Mki67 UTSW 7 135699720 missense probably benign 0.00
R1510:Mki67 UTSW 7 135696171 missense probably benign 0.26
R1573:Mki67 UTSW 7 135695116 missense possibly damaging 0.93
R1586:Mki67 UTSW 7 135713972 nonsense probably null
R1599:Mki67 UTSW 7 135699934 missense probably benign 0.34
R1623:Mki67 UTSW 7 135708818 splice site probably null
R1706:Mki67 UTSW 7 135700566 missense probably benign 0.37
R1718:Mki67 UTSW 7 135695494 missense probably damaging 1.00
R1785:Mki67 UTSW 7 135704241 critical splice acceptor site probably null
R1816:Mki67 UTSW 7 135707387 missense possibly damaging 0.68
R1862:Mki67 UTSW 7 135699361 missense probably benign 0.09
R1929:Mki67 UTSW 7 135698065 missense possibly damaging 0.46
R1957:Mki67 UTSW 7 135698399 missense probably benign 0.01
R1971:Mki67 UTSW 7 135713959 critical splice donor site probably null
R1998:Mki67 UTSW 7 135705770 missense probably benign 0.00
R2004:Mki67 UTSW 7 135698509 nonsense probably null
R2005:Mki67 UTSW 7 135698509 nonsense probably null
R2006:Mki67 UTSW 7 135698509 nonsense probably null
R2109:Mki67 UTSW 7 135697863 missense probably damaging 1.00
R2130:Mki67 UTSW 7 135704241 critical splice acceptor site probably null
R2131:Mki67 UTSW 7 135704241 critical splice acceptor site probably null
R2133:Mki67 UTSW 7 135704241 critical splice acceptor site probably null
R2140:Mki67 UTSW 7 135695592 missense possibly damaging 0.94
R2141:Mki67 UTSW 7 135695592 missense possibly damaging 0.94
R2142:Mki67 UTSW 7 135695592 missense possibly damaging 0.94
R2284:Mki67 UTSW 7 135699945 missense probably damaging 0.99
R2869:Mki67 UTSW 7 135708149 missense probably benign 0.19
R2869:Mki67 UTSW 7 135708149 missense probably benign 0.19
R2871:Mki67 UTSW 7 135708149 missense probably benign 0.19
R2871:Mki67 UTSW 7 135708149 missense probably benign 0.19
R2913:Mki67 UTSW 7 135700686 missense possibly damaging 0.71
R3404:Mki67 UTSW 7 135707475 missense probably benign 0.01
R3405:Mki67 UTSW 7 135707475 missense probably benign 0.01
R3406:Mki67 UTSW 7 135707475 missense probably benign 0.01
R3777:Mki67 UTSW 7 135696130 missense probably benign 0.10
R3778:Mki67 UTSW 7 135696130 missense probably benign 0.10
R3787:Mki67 UTSW 7 135700283 missense possibly damaging 0.93
R3847:Mki67 UTSW 7 135696130 missense probably benign 0.10
R3848:Mki67 UTSW 7 135696130 missense probably benign 0.10
R3853:Mki67 UTSW 7 135696130 missense probably benign 0.10
R3971:Mki67 UTSW 7 135696130 missense probably benign 0.10
R3972:Mki67 UTSW 7 135696130 missense probably benign 0.10
R4258:Mki67 UTSW 7 135695288 missense possibly damaging 0.86
R4343:Mki67 UTSW 7 135695118 missense probably benign 0.10
R4488:Mki67 UTSW 7 135697671 missense probably benign 0.01
R4528:Mki67 UTSW 7 135695359 missense probably damaging 1.00
R4713:Mki67 UTSW 7 135695469 missense probably benign 0.35
R4867:Mki67 UTSW 7 135699856 missense probably damaging 0.97
R4874:Mki67 UTSW 7 135708771 missense probably damaging 0.97
R4897:Mki67 UTSW 7 135696745 missense probably damaging 1.00
R5045:Mki67 UTSW 7 135707904 missense possibly damaging 0.84
R5306:Mki67 UTSW 7 135714001 missense probably damaging 1.00
R5309:Mki67 UTSW 7 135700830 missense probably damaging 1.00
R5312:Mki67 UTSW 7 135700830 missense probably damaging 1.00
R5379:Mki67 UTSW 7 135697461 missense possibly damaging 0.95
R5506:Mki67 UTSW 7 135699981 missense possibly damaging 0.60
R5513:Mki67 UTSW 7 135707750 missense probably damaging 0.98
R5742:Mki67 UTSW 7 135704373 missense probably benign 0.20
R5806:Mki67 UTSW 7 135704605 missense probably damaging 1.00
R6008:Mki67 UTSW 7 135697429 missense probably damaging 1.00
R6037:Mki67 UTSW 7 135696803 missense possibly damaging 0.69
R6037:Mki67 UTSW 7 135696803 missense possibly damaging 0.69
R6221:Mki67 UTSW 7 135697914 missense probably benign 0.18
R6294:Mki67 UTSW 7 135704590 missense probably benign 0.09
R6377:Mki67 UTSW 7 135696321 missense possibly damaging 0.67
R6456:Mki67 UTSW 7 135699475 missense possibly damaging 0.59
R6608:Mki67 UTSW 7 135698361 missense probably benign 0.01
R6609:Mki67 UTSW 7 135699829 missense possibly damaging 0.94
R6648:Mki67 UTSW 7 135697440 missense probably damaging 1.00
R6901:Mki67 UTSW 7 135708760 splice site probably null
R6978:Mki67 UTSW 7 135701962 missense probably benign 0.10
R6985:Mki67 UTSW 7 135713865 missense probably damaging 1.00
R7076:Mki67 UTSW 7 135705629 missense probably damaging 0.98
R7217:Mki67 UTSW 7 135704182 missense probably damaging 1.00
R7239:Mki67 UTSW 7 135700176 missense possibly damaging 0.91
R7250:Mki67 UTSW 7 135699324 missense possibly damaging 0.90
R7336:Mki67 UTSW 7 135713839 missense probably benign 0.03
X0020:Mki67 UTSW 7 135714001 missense probably damaging 0.96
X0065:Mki67 UTSW 7 135713844 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AAGCCCTGGTTCTCACAATG -3'
(R):5'- CAAGGTCCCTGAAATTGGTAAC -3'

Sequencing Primer
(F):5'- AGACTTCCTCTTCGGGGACAG -3'
(R):5'- CAATGGTACCCAAGTTTCAAAGG -3'
Posted On2019-06-26