Incidental Mutation 'R7316:Fsip2'
ID567941
Institutional Source Beutler Lab
Gene Symbol Fsip2
Ensembl Gene ENSMUSG00000075249
Gene Namefibrous sheath-interacting protein 2
SynonymsOTTMUSG00000013335
Accession Numbers

Genbank: XM_913669; MGI: 2664111

Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R7316 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location82943634-83008937 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 82989691 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Serine at position 5256 (Y5256S)
Ref Sequence ENSEMBL: ENSMUSP00000120314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000143764]
Predicted Effect probably benign
Transcript: ENSMUST00000132967
SMART Domains Protein: ENSMUSP00000122350
Gene: ENSMUSG00000075249

DomainStartEndE-ValueType
low complexity region 22 38 N/A INTRINSIC
low complexity region 79 90 N/A INTRINSIC
low complexity region 381 392 N/A INTRINSIC
low complexity region 411 430 N/A INTRINSIC
low complexity region 735 746 N/A INTRINSIC
low complexity region 953 962 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000143764
AA Change: Y5256S

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000120314
Gene: ENSMUSG00000075249
AA Change: Y5256S

DomainStartEndE-ValueType
coiled coil region 271 297 N/A INTRINSIC
low complexity region 544 561 N/A INTRINSIC
low complexity region 586 597 N/A INTRINSIC
low complexity region 882 895 N/A INTRINSIC
low complexity region 925 939 N/A INTRINSIC
low complexity region 1115 1120 N/A INTRINSIC
low complexity region 1531 1545 N/A INTRINSIC
low complexity region 2044 2057 N/A INTRINSIC
low complexity region 2507 2523 N/A INTRINSIC
low complexity region 2564 2575 N/A INTRINSIC
low complexity region 2866 2877 N/A INTRINSIC
low complexity region 2896 2915 N/A INTRINSIC
low complexity region 3220 3231 N/A INTRINSIC
low complexity region 3438 3447 N/A INTRINSIC
Pfam:FSIP2 4045 4408 3.5e-42 PFAM
Pfam:FSIP2 4375 4613 7.7e-26 PFAM
Pfam:FSIP2 4622 4932 4.3e-17 PFAM
Pfam:FSIP2 4903 5454 7e-27 PFAM
low complexity region 5507 5522 N/A INTRINSIC
low complexity region 5769 5780 N/A INTRINSIC
low complexity region 5834 5846 N/A INTRINSIC
low complexity region 5851 5867 N/A INTRINSIC
Pfam:FSIP2 5998 6867 N/A PFAM
low complexity region 6977 6990 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein associated with the sperm fibrous sheath. Genes encoding most of the fibrous-sheath associated proteins genes are transcribed only during the postmeiotic period of spermatogenesis. The protein encoded by this gene is specific to spermatogenic cells. Copy number variation in this gene may be associated with testicular germ cell tumors. Pseudogenes associated with this gene are reported on chromosomes 2 and X. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik A G 12: 55,304,644 D246G probably damaging Het
2810474O19Rik T C 6: 149,326,638 L394P probably damaging Het
4933434E20Rik G A 3: 90,061,713 M214I probably benign Het
Aadat G T 8: 60,526,634 G177C probably damaging Het
Adam4 T C 12: 81,419,724 I708V probably benign Het
Aip T C 19: 4,114,793 N264S probably benign Het
Alox8 A T 11: 69,186,238 D505E probably benign Het
Ap3d1 A T 10: 80,717,859 I518N probably damaging Het
Arf3 G A 15: 98,740,993 Q128* probably null Het
Asph A G 4: 9,537,746 V344A probably benign Het
Birc6 A T 17: 74,604,494 R1500S probably damaging Het
Bptf G A 11: 107,073,109 T1753I probably damaging Het
Bptf A T 11: 107,110,914 C457* probably null Het
Brpf3 T A 17: 28,814,686 I568N probably damaging Het
Btnl4 G C 17: 34,469,057 N582K probably benign Het
Camsap3 C A 8: 3,604,648 P773T possibly damaging Het
Capsl A T 15: 9,461,802 I95L probably benign Het
Cd96 T A 16: 46,069,653 M336L probably benign Het
Cdan1 A T 2: 120,728,332 probably null Het
Chd3 A T 11: 69,345,568 L1939Q probably damaging Het
Cngb3 A T 4: 19,425,599 Y469F probably benign Het
Cp T C 3: 19,972,752 L448P probably damaging Het
Csnk1g2 T C 10: 80,639,853 V418A possibly damaging Het
Dag1 A T 9: 108,209,502 S147T probably benign Het
Dnajc25 T A 4: 59,017,693 Y117* probably null Het
Dpysl2 A T 14: 66,862,595 M64K possibly damaging Het
Dus3l A G 17: 56,765,551 H38R possibly damaging Het
E330021D16Rik T C 6: 136,401,278 K185E possibly damaging Het
Eme2 G A 17: 24,894,866 R62W probably damaging Het
Enox1 A T 14: 77,720,858 M616L probably benign Het
Epb41l4b T A 4: 57,019,867 T708S probably benign Het
Fam71f2 A G 6: 29,286,102 M187V probably benign Het
Fat2 A T 11: 55,286,067 I1534N probably damaging Het
Fer1l5 A G 1: 36,418,116 T1649A probably benign Het
Fmo9 A G 1: 166,663,646 V421A probably benign Het
Gapvd1 G A 2: 34,704,669 L804F probably damaging Het
Gen1 A G 12: 11,241,469 V838A probably benign Het
Gnptab A T 10: 88,400,710 N59I probably damaging Het
Grm5 A G 7: 87,975,265 T347A probably benign Het
Gsdmc3 T C 15: 63,858,402 N438D possibly damaging Het
Hmcn1 A G 1: 150,732,946 L1495S probably damaging Het
Islr2 T C 9: 58,197,967 E714G probably damaging Het
Larp4 A T 15: 100,001,017 M430L probably benign Het
Lpcat2b A G 5: 107,433,113 I103V not run Het
Lrguk C T 6: 34,103,256 S1142F unknown Het
Lrit2 G T 14: 37,068,858 V165F probably damaging Het
Mast3 T A 8: 70,779,788 I1182F probably damaging Het
Mcm6 C T 1: 128,359,508 D20N probably damaging Het
Mief1 A G 15: 80,249,397 I218M probably damaging Het
Mmp2 A G 8: 92,840,410 T453A probably benign Het
Ms4a18 T A 19: 11,001,996 S219C probably damaging Het
Myo5c A T 9: 75,269,638 T622S probably benign Het
Neb A T 2: 52,271,438 M2114K possibly damaging Het
Nemp1 T A 10: 127,689,343 L122* probably null Het
Nkx2-1 T C 12: 56,534,798 N88S probably benign Het
Nr2c2 T A 6: 92,154,463 C202S probably damaging Het
Ntsr1 A C 2: 180,500,752 D112A probably damaging Het
Olfr114 A G 17: 37,590,135 S73P probably damaging Het
Olfr430 A T 1: 174,070,161 I288F probably benign Het
Olfr680-ps1 A T 7: 105,090,900 H246Q probably damaging Het
Osbp2 C A 11: 3,726,431 R73L probably damaging Het
Pbp2 T A 6: 135,309,832 E172D probably damaging Het
Pcdhgc3 T C 18: 37,808,448 I634T probably benign Het
Phyh A T 2: 4,936,044 K252* probably null Het
Plcb3 C T 19: 6,966,385 probably null Het
Ppargc1b T C 18: 61,307,838 S670G probably damaging Het
Ptprc T C 1: 138,064,771 Y1067C probably damaging Het
Pwwp2b A C 7: 139,256,224 E527A probably benign Het
Pzp T C 6: 128,513,773 D409G probably damaging Het
Rbfox2 A T 15: 77,132,729 N148K possibly damaging Het
Rps24 T C 14: 24,490,689 probably benign Het
Slc35e4 T C 11: 3,912,584 K202E probably damaging Het
Spata7 C T 12: 98,658,612 R258W probably damaging Het
Spen A T 4: 141,477,054 S1421T unknown Het
Svep1 T A 4: 58,068,763 I3008F possibly damaging Het
Tbc1d1 G T 5: 64,335,277 probably null Het
Thsd4 T A 9: 59,987,359 H772L probably benign Het
Tle1 T C 4: 72,118,292 I769V probably benign Het
Tm4sf19 T A 16: 32,407,648 S127T possibly damaging Het
Tmprss9 C A 10: 80,894,979 R780S probably benign Het
Tpp2 T C 1: 43,970,431 V475A probably benign Het
Ttc30a1 A T 2: 75,980,857 L294Q probably damaging Het
Ttn A T 2: 76,766,913 N19885K probably damaging Het
Ttn A G 2: 76,862,165 V471A Het
Tub A T 7: 109,030,171 T478S possibly damaging Het
Vmn2r88 A T 14: 51,414,255 Y342F Het
Wdr18 C A 10: 79,965,225 D157E probably benign Het
Xrra1 A T 7: 99,876,216 probably null Het
Zc3h4 G C 7: 16,435,335 G1198A unknown Het
Zfp568 A T 7: 30,022,256 I209F possibly damaging Het
Zfp787 C A 7: 6,155,524 probably benign Het
Zfp974 A T 7: 27,910,438 Y621N possibly damaging Het
Zyg11b A G 4: 108,250,502 I493T possibly damaging Het
Other mutations in Fsip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Fsip2 APN 2 82990386 missense probably benign 0.18
IGL00557:Fsip2 APN 2 82991313 missense possibly damaging 0.53
IGL01343:Fsip2 APN 2 82999819 missense possibly damaging 0.53
IGL01387:Fsip2 APN 2 82992982 missense possibly damaging 0.71
IGL01523:Fsip2 APN 2 82977519 missense probably benign
IGL01554:Fsip2 APN 2 82977278 missense possibly damaging 0.68
IGL01650:Fsip2 APN 2 82991086 missense probably benign 0.33
IGL01809:Fsip2 APN 2 82978347 missense possibly damaging 0.80
IGL01826:Fsip2 APN 2 82982639 missense probably benign 0.18
IGL01830:Fsip2 APN 2 82984929 missense probably benign
IGL01918:Fsip2 APN 2 82992138 missense possibly damaging 0.71
IGL01932:Fsip2 APN 2 82994005 missense possibly damaging 0.71
IGL01989:Fsip2 APN 2 82993867 missense probably damaging 0.99
IGL02096:Fsip2 APN 2 82991860 missense possibly damaging 0.85
IGL02153:Fsip2 APN 2 82978721 missense probably benign
IGL02155:Fsip2 APN 2 82998352 missense probably benign
IGL02219:Fsip2 APN 2 82977830 missense probably benign 0.07
IGL02248:Fsip2 APN 2 82982772 missense possibly damaging 0.73
IGL02316:Fsip2 APN 2 82978793 missense probably benign
IGL02478:Fsip2 APN 2 82984392 missense probably benign 0.00
IGL02504:Fsip2 APN 2 82978855 missense possibly damaging 0.83
IGL02572:Fsip2 APN 2 82992003 missense probably benign 0.32
IGL02625:Fsip2 APN 2 82949492 missense probably benign 0.00
IGL02665:Fsip2 APN 2 82993063 missense probably damaging 1.00
IGL02668:Fsip2 APN 2 82998318 missense probably benign 0.06
IGL02676:Fsip2 APN 2 82982157 missense possibly damaging 0.53
IGL02717:Fsip2 APN 2 82951026 splice site probably benign
IGL02805:Fsip2 APN 2 82993495 missense probably benign 0.01
IGL02943:Fsip2 APN 2 82992357 missense probably benign 0.32
IGL02965:Fsip2 APN 2 82983054 missense probably benign 0.33
IGL03001:Fsip2 APN 2 82990624 intron probably benign
IGL03076:Fsip2 APN 2 82982138 missense possibly damaging 0.96
IGL03229:Fsip2 APN 2 82978076 missense possibly damaging 0.86
IGL03353:Fsip2 APN 2 82977393 missense possibly damaging 0.85
IGL03401:Fsip2 APN 2 82990470 missense probably benign
bubblegum UTSW 2 82992840 missense probably benign 0.16
engulf UTSW 2 82984776 missense probably damaging 0.98
envelope UTSW 2 82980741 missense probably benign 0.07
glove UTSW 2 82978394 missense possibly damaging 0.85
swaddle UTSW 2 82983428 missense possibly damaging 0.93
wrap UTSW 2 82986820 missense probably benign 0.04
wrapper UTSW 2 82990086 missense possibly damaging 0.71
D4186:Fsip2 UTSW 2 82988412 missense probably benign 0.32
FR4976:Fsip2 UTSW 2 82984362 critical splice acceptor site probably benign
FR4976:Fsip2 UTSW 2 82984365 critical splice acceptor site probably benign
PIT4382001:Fsip2 UTSW 2 82990852 missense possibly damaging 0.86
R0017:Fsip2 UTSW 2 82992072 missense probably damaging 0.98
R0017:Fsip2 UTSW 2 82992072 missense probably damaging 0.98
R0021:Fsip2 UTSW 2 82999857 splice site probably benign
R0054:Fsip2 UTSW 2 82976608 missense probably damaging 0.96
R0054:Fsip2 UTSW 2 82986955 missense possibly damaging 0.85
R0054:Fsip2 UTSW 2 82986955 missense possibly damaging 0.85
R0104:Fsip2 UTSW 2 82978973 missense possibly damaging 0.91
R0104:Fsip2 UTSW 2 82978973 missense possibly damaging 0.91
R0127:Fsip2 UTSW 2 82984925 missense probably benign 0.28
R0131:Fsip2 UTSW 2 82991121 missense probably benign
R0149:Fsip2 UTSW 2 82975505 missense possibly damaging 0.93
R0167:Fsip2 UTSW 2 82980807 missense possibly damaging 0.53
R0190:Fsip2 UTSW 2 82985177 missense possibly damaging 0.73
R0323:Fsip2 UTSW 2 82985896 missense probably benign 0.33
R0358:Fsip2 UTSW 2 82983333 missense possibly damaging 0.56
R0361:Fsip2 UTSW 2 82975505 missense possibly damaging 0.93
R0369:Fsip2 UTSW 2 82984564 missense probably benign 0.33
R0394:Fsip2 UTSW 2 82991075 missense possibly damaging 0.70
R0532:Fsip2 UTSW 2 82977785 missense probably benign 0.33
R0595:Fsip2 UTSW 2 82946952 missense probably damaging 0.99
R0613:Fsip2 UTSW 2 82993795 missense probably damaging 0.99
R0614:Fsip2 UTSW 2 82977533 missense probably benign 0.15
R0619:Fsip2 UTSW 2 82944140 missense probably damaging 1.00
R0626:Fsip2 UTSW 2 82988958 missense probably benign 0.06
R0644:Fsip2 UTSW 2 82976897 missense probably benign 0.02
R0661:Fsip2 UTSW 2 82986169 missense possibly damaging 0.92
R0680:Fsip2 UTSW 2 82991359 missense possibly damaging 0.73
R0688:Fsip2 UTSW 2 82982339 missense probably benign 0.18
R0881:Fsip2 UTSW 2 82986273 missense possibly damaging 0.52
R0919:Fsip2 UTSW 2 82985484 missense possibly damaging 0.53
R0973:Fsip2 UTSW 2 82977092 missense probably benign 0.05
R0973:Fsip2 UTSW 2 82977092 missense probably benign 0.05
R0974:Fsip2 UTSW 2 82977092 missense probably benign 0.05
R0976:Fsip2 UTSW 2 82998031 missense possibly damaging 0.92
R1025:Fsip2 UTSW 2 82989436 nonsense probably null
R1026:Fsip2 UTSW 2 82988461 missense possibly damaging 0.52
R1140:Fsip2 UTSW 2 82975034 missense probably damaging 0.99
R1170:Fsip2 UTSW 2 82991500 missense possibly damaging 0.72
R1180:Fsip2 UTSW 2 82975226 missense probably damaging 0.99
R1188:Fsip2 UTSW 2 82975017 missense possibly damaging 0.96
R1226:Fsip2 UTSW 2 82981011 missense probably damaging 0.96
R1248:Fsip2 UTSW 2 82989763 missense possibly damaging 0.93
R1273:Fsip2 UTSW 2 82989408 missense possibly damaging 0.92
R1323:Fsip2 UTSW 2 82985752 missense probably damaging 1.00
R1323:Fsip2 UTSW 2 82985752 missense probably damaging 1.00
R1356:Fsip2 UTSW 2 82989745 missense probably benign 0.38
R1413:Fsip2 UTSW 2 82988418 missense possibly damaging 0.93
R1430:Fsip2 UTSW 2 82998063 missense possibly damaging 0.71
R1475:Fsip2 UTSW 2 82987195 missense probably damaging 0.99
R1489:Fsip2 UTSW 2 82979811 missense probably benign
R1520:Fsip2 UTSW 2 82980714 missense possibly damaging 0.96
R1543:Fsip2 UTSW 2 82981587 missense possibly damaging 0.91
R1581:Fsip2 UTSW 2 82986282 missense probably damaging 0.98
R1590:Fsip2 UTSW 2 82982787 missense probably benign 0.26
R1646:Fsip2 UTSW 2 82978517 missense probably benign 0.07
R1678:Fsip2 UTSW 2 82986345 missense probably benign
R1700:Fsip2 UTSW 2 82991737 missense probably benign 0.33
R1717:Fsip2 UTSW 2 82974945 missense possibly damaging 0.68
R1741:Fsip2 UTSW 2 82989912 missense probably benign 0.32
R1760:Fsip2 UTSW 2 82984896 missense probably benign 0.07
R1760:Fsip2 UTSW 2 82987711 missense possibly damaging 0.71
R1760:Fsip2 UTSW 2 82999841 missense possibly damaging 0.85
R1789:Fsip2 UTSW 2 82977562 missense probably benign 0.00
R1850:Fsip2 UTSW 2 82984589 missense possibly damaging 0.72
R1854:Fsip2 UTSW 2 82993257 missense possibly damaging 0.84
R1888:Fsip2 UTSW 2 82944160 missense probably benign 0.04
R1888:Fsip2 UTSW 2 82944160 missense probably benign 0.04
R1905:Fsip2 UTSW 2 82983428 missense possibly damaging 0.93
R1907:Fsip2 UTSW 2 82983428 missense possibly damaging 0.93
R1920:Fsip2 UTSW 2 82986820 missense probably benign 0.04
R1921:Fsip2 UTSW 2 82980783 nonsense probably null
R1921:Fsip2 UTSW 2 82986820 missense probably benign 0.04
R1931:Fsip2 UTSW 2 82986733 missense probably damaging 0.99
R1934:Fsip2 UTSW 2 82980558 missense possibly damaging 0.91
R1959:Fsip2 UTSW 2 82991550 missense probably benign
R1965:Fsip2 UTSW 2 82992780 missense possibly damaging 0.86
R1966:Fsip2 UTSW 2 82992780 missense possibly damaging 0.86
R1983:Fsip2 UTSW 2 82979831 missense probably benign
R1988:Fsip2 UTSW 2 82976517 missense possibly damaging 0.56
R2016:Fsip2 UTSW 2 82982732 missense possibly damaging 0.53
R2017:Fsip2 UTSW 2 82982732 missense possibly damaging 0.53
R2026:Fsip2 UTSW 2 82989444 missense possibly damaging 0.71
R2034:Fsip2 UTSW 2 82989494 missense probably benign 0.43
R2037:Fsip2 UTSW 2 82978512 missense probably damaging 0.99
R2070:Fsip2 UTSW 2 82976355 missense probably damaging 0.98
R2072:Fsip2 UTSW 2 83008815 missense possibly damaging 0.53
R2075:Fsip2 UTSW 2 82988579 missense possibly damaging 0.85
R2143:Fsip2 UTSW 2 82990271 missense possibly damaging 0.93
R2207:Fsip2 UTSW 2 82977479 missense probably benign 0.02
R2256:Fsip2 UTSW 2 82962751 missense probably benign 0.07
R2315:Fsip2 UTSW 2 82975093 missense probably benign
R2344:Fsip2 UTSW 2 82989913 missense possibly damaging 0.71
R2377:Fsip2 UTSW 2 82976249 missense probably benign 0.29
R2403:Fsip2 UTSW 2 82980720 missense possibly damaging 0.53
R2441:Fsip2 UTSW 2 82985341 missense possibly damaging 0.53
R2504:Fsip2 UTSW 2 82979610 missense possibly damaging 0.86
R2510:Fsip2 UTSW 2 82986438 missense probably benign
R2511:Fsip2 UTSW 2 82951657 missense probably damaging 1.00
R2511:Fsip2 UTSW 2 82986438 missense probably benign
R2512:Fsip2 UTSW 2 82978167 missense probably benign 0.04
R2568:Fsip2 UTSW 2 82990431 missense probably benign 0.14
R2656:Fsip2 UTSW 2 82979045 missense possibly damaging 0.83
R2883:Fsip2 UTSW 2 82991524 missense possibly damaging 0.86
R3417:Fsip2 UTSW 2 82986510 missense possibly damaging 0.51
R3431:Fsip2 UTSW 2 82992010 missense possibly damaging 0.85
R3441:Fsip2 UTSW 2 82986727 missense probably benign 0.00
R3605:Fsip2 UTSW 2 82984909 missense probably benign 0.28
R3620:Fsip2 UTSW 2 82980258 missense probably benign 0.00
R3621:Fsip2 UTSW 2 82980258 missense probably benign 0.00
R3726:Fsip2 UTSW 2 82988967 missense possibly damaging 0.84
R3755:Fsip2 UTSW 2 82978217 missense probably benign 0.26
R3789:Fsip2 UTSW 2 82982714 missense probably damaging 0.96
R3836:Fsip2 UTSW 2 82950946 missense probably damaging 1.00
R3844:Fsip2 UTSW 2 82989606 missense possibly damaging 0.52
R3846:Fsip2 UTSW 2 82986415 missense possibly damaging 0.52
R3861:Fsip2 UTSW 2 82984776 missense probably damaging 0.98
R3981:Fsip2 UTSW 2 82958662 missense probably benign 0.08
R4014:Fsip2 UTSW 2 82983518 missense probably benign
R4042:Fsip2 UTSW 2 82983552 missense probably benign 0.02
R4075:Fsip2 UTSW 2 82982901 missense probably benign 0.26
R4154:Fsip2 UTSW 2 82987069 missense possibly damaging 0.71
R4210:Fsip2 UTSW 2 82975149 missense probably damaging 0.99
R4211:Fsip2 UTSW 2 82975149 missense probably damaging 0.99
R4327:Fsip2 UTSW 2 82987059 missense probably benign 0.25
R4332:Fsip2 UTSW 2 82977857 missense probably benign 0.00
R4440:Fsip2 UTSW 2 82991206 missense possibly damaging 0.85
R4454:Fsip2 UTSW 2 82990776 missense possibly damaging 0.70
R4455:Fsip2 UTSW 2 82990776 missense possibly damaging 0.70
R4457:Fsip2 UTSW 2 82990776 missense possibly damaging 0.70
R4458:Fsip2 UTSW 2 82990776 missense possibly damaging 0.70
R4540:Fsip2 UTSW 2 82951665 missense probably benign
R4549:Fsip2 UTSW 2 82989628 missense probably damaging 0.99
R4558:Fsip2 UTSW 2 82984953 missense possibly damaging 0.73
R4573:Fsip2 UTSW 2 82986166 missense possibly damaging 0.71
R4583:Fsip2 UTSW 2 82978673 missense probably benign 0.33
R4618:Fsip2 UTSW 2 82987759 missense probably benign
R4700:Fsip2 UTSW 2 82987029 missense probably benign 0.32
R4716:Fsip2 UTSW 2 82974859 missense probably damaging 0.96
R4739:Fsip2 UTSW 2 82975353 missense possibly damaging 0.92
R4749:Fsip2 UTSW 2 82989285 missense probably benign 0.06
R4791:Fsip2 UTSW 2 82982108 missense possibly damaging 0.53
R4793:Fsip2 UTSW 2 82987700 nonsense probably null
R4819:Fsip2 UTSW 2 82988442 missense probably benign 0.06
R4832:Fsip2 UTSW 2 82990171 missense possibly damaging 0.92
R4840:Fsip2 UTSW 2 82949395 missense probably benign 0.01
R4840:Fsip2 UTSW 2 82985471 missense probably benign 0.26
R4865:Fsip2 UTSW 2 82990951 missense possibly damaging 0.86
R4876:Fsip2 UTSW 2 82974858 missense possibly damaging 0.91
R4885:Fsip2 UTSW 2 82988094 missense probably benign 0.02
R4911:Fsip2 UTSW 2 82981493 missense possibly damaging 0.85
R4918:Fsip2 UTSW 2 82993770 missense possibly damaging 0.51
R4936:Fsip2 UTSW 2 82985040 missense probably benign 0.18
R4950:Fsip2 UTSW 2 82946932 missense probably damaging 0.97
R4950:Fsip2 UTSW 2 82977414 missense probably benign 0.03
R4959:Fsip2 UTSW 2 82984825 missense probably benign 0.00
R4971:Fsip2 UTSW 2 82985878 missense probably benign 0.38
R4973:Fsip2 UTSW 2 82984825 missense probably benign 0.00
R4976:Fsip2 UTSW 2 82988191 missense probably damaging 0.99
R5022:Fsip2 UTSW 2 82979429 missense probably benign 0.33
R5027:Fsip2 UTSW 2 82989133 missense possibly damaging 0.71
R5030:Fsip2 UTSW 2 82988492 missense possibly damaging 0.85
R5048:Fsip2 UTSW 2 82993150 missense probably damaging 0.97
R5096:Fsip2 UTSW 2 82991116 missense probably benign 0.00
R5097:Fsip2 UTSW 2 82991985 missense probably benign
R5119:Fsip2 UTSW 2 82988191 missense probably damaging 0.99
R5138:Fsip2 UTSW 2 82981424 missense probably benign 0.12
R5152:Fsip2 UTSW 2 82978572 missense probably benign 0.43
R5174:Fsip2 UTSW 2 82980741 missense probably benign 0.07
R5193:Fsip2 UTSW 2 82982994 missense possibly damaging 0.53
R5245:Fsip2 UTSW 2 82993161 missense probably benign 0.02
R5282:Fsip2 UTSW 2 82978581 missense possibly damaging 0.61
R5323:Fsip2 UTSW 2 82988145 missense possibly damaging 0.71
R5326:Fsip2 UTSW 2 82981863 missense possibly damaging 0.84
R5378:Fsip2 UTSW 2 82989841 missense possibly damaging 0.71
R5380:Fsip2 UTSW 2 82975398 missense possibly damaging 0.91
R5396:Fsip2 UTSW 2 82990918 missense probably benign 0.00
R5422:Fsip2 UTSW 2 82982228 missense probably benign 0.00
R5481:Fsip2 UTSW 2 82979886 missense probably benign 0.26
R5482:Fsip2 UTSW 2 82985310 missense possibly damaging 0.80
R5513:Fsip2 UTSW 2 82950908 missense probably damaging 1.00
R5513:Fsip2 UTSW 2 82950912 missense probably benign 0.07
R5513:Fsip2 UTSW 2 82985198 missense possibly damaging 0.72
R5536:Fsip2 UTSW 2 82987059 missense probably benign 0.25
R5542:Fsip2 UTSW 2 82981863 missense possibly damaging 0.84
R5553:Fsip2 UTSW 2 82962746 missense probably benign
R5568:Fsip2 UTSW 2 82986564 missense probably benign 0.25
R5581:Fsip2 UTSW 2 82998128 missense possibly damaging 0.84
R5664:Fsip2 UTSW 2 82988095 missense probably benign 0.05
R5672:Fsip2 UTSW 2 82987494 nonsense probably null
R5712:Fsip2 UTSW 2 83008848 missense possibly damaging 0.73
R5762:Fsip2 UTSW 2 82977916 missense probably benign 0.33
R5772:Fsip2 UTSW 2 82984740 missense probably benign
R5881:Fsip2 UTSW 2 82984441 missense possibly damaging 0.72
R5919:Fsip2 UTSW 2 82992609 missense possibly damaging 0.71
R5920:Fsip2 UTSW 2 82988508 nonsense probably null
R5934:Fsip2 UTSW 2 82986748 missense possibly damaging 0.86
R5938:Fsip2 UTSW 2 82977491 missense probably benign 0.00
R5974:Fsip2 UTSW 2 82963313 missense possibly damaging 0.68
R5991:Fsip2 UTSW 2 82990468 missense probably benign 0.28
R6019:Fsip2 UTSW 2 82987939 missense possibly damaging 0.52
R6020:Fsip2 UTSW 2 82992127 missense probably damaging 0.99
R6056:Fsip2 UTSW 2 82985673 missense probably benign 0.01
R6057:Fsip2 UTSW 2 82979433 missense probably damaging 0.99
R6139:Fsip2 UTSW 2 82991044 missense possibly damaging 0.85
R6145:Fsip2 UTSW 2 82993768 missense possibly damaging 0.71
R6160:Fsip2 UTSW 2 82987945 nonsense probably null
R6161:Fsip2 UTSW 2 82987257 missense possibly damaging 0.80
R6166:Fsip2 UTSW 2 82980727 missense probably benign 0.00
R6187:Fsip2 UTSW 2 82982454 missense probably benign 0.33
R6196:Fsip2 UTSW 2 82989883 missense possibly damaging 0.71
R6217:Fsip2 UTSW 2 82988418 missense possibly damaging 0.93
R6276:Fsip2 UTSW 2 82980441 missense possibly damaging 0.91
R6278:Fsip2 UTSW 2 82988898 missense probably benign 0.16
R6349:Fsip2 UTSW 2 82993072 missense probably benign 0.05
R6351:Fsip2 UTSW 2 82992684 missense possibly damaging 0.51
R6401:Fsip2 UTSW 2 82990086 missense possibly damaging 0.71
R6404:Fsip2 UTSW 2 82990086 missense possibly damaging 0.71
R6405:Fsip2 UTSW 2 82990086 missense possibly damaging 0.71
R6437:Fsip2 UTSW 2 82983492 missense possibly damaging 0.73
R6478:Fsip2 UTSW 2 82990086 missense possibly damaging 0.71
R6479:Fsip2 UTSW 2 82990086 missense possibly damaging 0.71
R6480:Fsip2 UTSW 2 82990086 missense possibly damaging 0.71
R6481:Fsip2 UTSW 2 82990086 missense possibly damaging 0.71
R6521:Fsip2 UTSW 2 82990086 missense possibly damaging 0.71
R6529:Fsip2 UTSW 2 82982313 missense probably benign
R6621:Fsip2 UTSW 2 82989814 missense possibly damaging 0.93
R6639:Fsip2 UTSW 2 82983227 missense possibly damaging 0.85
R6649:Fsip2 UTSW 2 82967817 missense possibly damaging 0.83
R6714:Fsip2 UTSW 2 82979534 missense probably benign 0.01
R6714:Fsip2 UTSW 2 82990086 missense possibly damaging 0.71
R6749:Fsip2 UTSW 2 82978394 missense possibly damaging 0.85
R6765:Fsip2 UTSW 2 82986432 missense probably benign
R6790:Fsip2 UTSW 2 82990939 missense possibly damaging 0.53
R6793:Fsip2 UTSW 2 82989494 missense probably benign 0.43
R6795:Fsip2 UTSW 2 82980959 missense probably benign 0.08
R6818:Fsip2 UTSW 2 82985200 missense probably benign 0.04
R6844:Fsip2 UTSW 2 82983625 missense possibly damaging 0.72
R6848:Fsip2 UTSW 2 82982787 missense probably benign 0.26
R6945:Fsip2 UTSW 2 82992840 missense probably benign 0.16
R6950:Fsip2 UTSW 2 82985988 missense probably benign 0.03
R6951:Fsip2 UTSW 2 82981949 missense possibly damaging 0.68
R6974:Fsip2 UTSW 2 82978717 missense probably damaging 0.96
R6987:Fsip2 UTSW 2 82948286 nonsense probably null
R6989:Fsip2 UTSW 2 82976954 missense probably benign 0.00
R7001:Fsip2 UTSW 2 82986925 missense probably damaging 1.00
R7002:Fsip2 UTSW 2 82989343 missense possibly damaging 0.86
R7016:Fsip2 UTSW 2 82990635 missense probably benign 0.25
R7066:Fsip2 UTSW 2 82990891 missense possibly damaging 0.86
R7067:Fsip2 UTSW 2 82980734 missense possibly damaging 0.85
R7077:Fsip2 UTSW 2 82983152 missense probably benign 0.18
R7099:Fsip2 UTSW 2 82987624 missense probably benign
R7126:Fsip2 UTSW 2 82983141 missense possibly damaging 0.53
R7156:Fsip2 UTSW 2 82982741 missense probably benign 0.00
R7165:Fsip2 UTSW 2 82981197 missense possibly damaging 0.77
R7171:Fsip2 UTSW 2 82986227 nonsense probably null
R7189:Fsip2 UTSW 2 82993237 missense possibly damaging 0.92
R7217:Fsip2 UTSW 2 82989068 missense possibly damaging 0.85
R7222:Fsip2 UTSW 2 82983671 missense probably benign
R7228:Fsip2 UTSW 2 82992307 missense possibly damaging 0.93
R7238:Fsip2 UTSW 2 82982140 missense possibly damaging 0.72
R7244:Fsip2 UTSW 2 82993263 missense possibly damaging 0.92
R7251:Fsip2 UTSW 2 82979081 missense possibly damaging 0.95
R7259:Fsip2 UTSW 2 82982130 missense possibly damaging 0.85
R7291:Fsip2 UTSW 2 82980519 missense possibly damaging 0.91
R7323:Fsip2 UTSW 2 82989516 missense probably benign 0.07
X0018:Fsip2 UTSW 2 82982507 nonsense probably null
X0020:Fsip2 UTSW 2 82951020 missense probably damaging 1.00
X0025:Fsip2 UTSW 2 82954946 missense possibly damaging 0.70
X0027:Fsip2 UTSW 2 82976778 missense probably benign 0.35
X0066:Fsip2 UTSW 2 82987463 missense possibly damaging 0.51
Z1088:Fsip2 UTSW 2 82975448 missense probably damaging 0.96
Z1088:Fsip2 UTSW 2 82987653 missense possibly damaging 0.86
Z1088:Fsip2 UTSW 2 82988634 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- TGCAGAGGATACAGCCAGTATG -3'
(R):5'- AGCTAAGCTTACAATTTCTGCC -3'

Sequencing Primer
(F):5'- ACAGCCAGTATGATATATGAAACAAC -3'
(R):5'- AAGCTTACAATTTCTGCCTCTGG -3'
Posted On2019-06-26