Incidental Mutation 'R7316:Dnajc25'
ID567950
Institutional Source Beutler Lab
Gene Symbol Dnajc25
Ensembl Gene ENSMUSG00000070972
Gene NameDnaJ heat shock protein family (Hsp40) member C25
Synonyms2010203O07Rik, 2010109C08Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R7316 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location58995062-59025573 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 59017693 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 117 (Y117*)
Ref Sequence ENSEMBL: ENSMUSP00000092680 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095070] [ENSMUST00000148366] [ENSMUST00000150309] [ENSMUST00000152199] [ENSMUST00000153467] [ENSMUST00000174664]
Predicted Effect probably null
Transcript: ENSMUST00000095070
AA Change: Y117*
SMART Domains Protein: ENSMUSP00000092680
Gene: ENSMUSG00000070972
AA Change: Y117*

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
DnaJ 47 113 2.04e-19 SMART
low complexity region 125 138 N/A INTRINSIC
transmembrane domain 147 164 N/A INTRINSIC
coiled coil region 195 220 N/A INTRINSIC
transmembrane domain 241 263 N/A INTRINSIC
low complexity region 313 331 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148366
SMART Domains Protein: ENSMUSP00000116171
Gene: ENSMUSG00000070972

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
transmembrane domain 24 46 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150309
SMART Domains Protein: ENSMUSP00000123172
Gene: ENSMUSG00000070972

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
DnaJ 47 113 4.18e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152199
SMART Domains Protein: ENSMUSP00000118048
Gene: ENSMUSG00000070972

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
transmembrane domain 28 45 N/A INTRINSIC
coiled coil region 76 101 N/A INTRINSIC
transmembrane domain 122 144 N/A INTRINSIC
low complexity region 194 212 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153467
SMART Domains Protein: ENSMUSP00000114320
Gene: ENSMUSG00000070972

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
DnaJ 47 113 1.12e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174664
SMART Domains Protein: ENSMUSP00000134530
Gene: ENSMUSG00000092345

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
DnaJ 47 113 3.9e-16 SMART
G_gamma 94 150 1.06e-6 SMART
GGL 94 150 1.05e-9 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik A G 12: 55,304,644 D246G probably damaging Het
2810474O19Rik T C 6: 149,326,638 L394P probably damaging Het
4933434E20Rik G A 3: 90,061,713 M214I probably benign Het
Aadat G T 8: 60,526,634 G177C probably damaging Het
Adam4 T C 12: 81,419,724 I708V probably benign Het
Aip T C 19: 4,114,793 N264S probably benign Het
Alox8 A T 11: 69,186,238 D505E probably benign Het
Ap3d1 A T 10: 80,717,859 I518N probably damaging Het
Arf3 G A 15: 98,740,993 Q128* probably null Het
Asph A G 4: 9,537,746 V344A probably benign Het
Birc6 A T 17: 74,604,494 R1500S probably damaging Het
Bptf G A 11: 107,073,109 T1753I probably damaging Het
Bptf A T 11: 107,110,914 C457* probably null Het
Brpf3 T A 17: 28,814,686 I568N probably damaging Het
Btnl4 G C 17: 34,469,057 N582K probably benign Het
Camsap3 C A 8: 3,604,648 P773T possibly damaging Het
Capsl A T 15: 9,461,802 I95L probably benign Het
Cd96 T A 16: 46,069,653 M336L probably benign Het
Cdan1 A T 2: 120,728,332 probably null Het
Chd3 A T 11: 69,345,568 L1939Q probably damaging Het
Cngb3 A T 4: 19,425,599 Y469F probably benign Het
Cp T C 3: 19,972,752 L448P probably damaging Het
Csnk1g2 T C 10: 80,639,853 V418A possibly damaging Het
Dag1 A T 9: 108,209,502 S147T probably benign Het
Dpysl2 A T 14: 66,862,595 M64K possibly damaging Het
Dus3l A G 17: 56,765,551 H38R possibly damaging Het
E330021D16Rik T C 6: 136,401,278 K185E possibly damaging Het
Eme2 G A 17: 24,894,866 R62W probably damaging Het
Enox1 A T 14: 77,720,858 M616L probably benign Het
Epb41l4b T A 4: 57,019,867 T708S probably benign Het
Fam71f2 A G 6: 29,286,102 M187V probably benign Het
Fat2 A T 11: 55,286,067 I1534N probably damaging Het
Fer1l5 A G 1: 36,418,116 T1649A probably benign Het
Fmo9 A G 1: 166,663,646 V421A probably benign Het
Fsip2 A C 2: 82,989,691 Y5256S possibly damaging Het
Gapvd1 G A 2: 34,704,669 L804F probably damaging Het
Gen1 A G 12: 11,241,469 V838A probably benign Het
Gnptab A T 10: 88,400,710 N59I probably damaging Het
Grm5 A G 7: 87,975,265 T347A probably benign Het
Gsdmc3 T C 15: 63,858,402 N438D possibly damaging Het
Hmcn1 A G 1: 150,732,946 L1495S probably damaging Het
Islr2 T C 9: 58,197,967 E714G probably damaging Het
Larp4 A T 15: 100,001,017 M430L probably benign Het
Lpcat2b A G 5: 107,433,113 I103V not run Het
Lrguk C T 6: 34,103,256 S1142F unknown Het
Lrit2 G T 14: 37,068,858 V165F probably damaging Het
Mast3 T A 8: 70,779,788 I1182F probably damaging Het
Mcm6 C T 1: 128,359,508 D20N probably damaging Het
Mief1 A G 15: 80,249,397 I218M probably damaging Het
Mmp2 A G 8: 92,840,410 T453A probably benign Het
Ms4a18 T A 19: 11,001,996 S219C probably damaging Het
Myo5c A T 9: 75,269,638 T622S probably benign Het
Neb A T 2: 52,271,438 M2114K possibly damaging Het
Nemp1 T A 10: 127,689,343 L122* probably null Het
Nkx2-1 T C 12: 56,534,798 N88S probably benign Het
Nr2c2 T A 6: 92,154,463 C202S probably damaging Het
Ntsr1 A C 2: 180,500,752 D112A probably damaging Het
Olfr114 A G 17: 37,590,135 S73P probably damaging Het
Olfr430 A T 1: 174,070,161 I288F probably benign Het
Olfr680-ps1 A T 7: 105,090,900 H246Q probably damaging Het
Osbp2 C A 11: 3,726,431 R73L probably damaging Het
Pbp2 T A 6: 135,309,832 E172D probably damaging Het
Pcdhgc3 T C 18: 37,808,448 I634T probably benign Het
Phyh A T 2: 4,936,044 K252* probably null Het
Plcb3 C T 19: 6,966,385 probably null Het
Ppargc1b T C 18: 61,307,838 S670G probably damaging Het
Ptprc T C 1: 138,064,771 Y1067C probably damaging Het
Pwwp2b A C 7: 139,256,224 E527A probably benign Het
Pzp T C 6: 128,513,773 D409G probably damaging Het
Rbfox2 A T 15: 77,132,729 N148K possibly damaging Het
Rps24 T C 14: 24,490,689 probably benign Het
Slc35e4 T C 11: 3,912,584 K202E probably damaging Het
Spata7 C T 12: 98,658,612 R258W probably damaging Het
Spen A T 4: 141,477,054 S1421T unknown Het
Svep1 T A 4: 58,068,763 I3008F possibly damaging Het
Tbc1d1 G T 5: 64,335,277 probably null Het
Thsd4 T A 9: 59,987,359 H772L probably benign Het
Tle1 T C 4: 72,118,292 I769V probably benign Het
Tm4sf19 T A 16: 32,407,648 S127T possibly damaging Het
Tmprss9 C A 10: 80,894,979 R780S probably benign Het
Tpp2 T C 1: 43,970,431 V475A probably benign Het
Ttc30a1 A T 2: 75,980,857 L294Q probably damaging Het
Ttn A T 2: 76,766,913 N19885K probably damaging Het
Ttn A G 2: 76,862,165 V471A Het
Tub A T 7: 109,030,171 T478S possibly damaging Het
Vmn2r88 A T 14: 51,414,255 Y342F Het
Wdr18 C A 10: 79,965,225 D157E probably benign Het
Xrra1 A T 7: 99,876,216 probably null Het
Zc3h4 G C 7: 16,435,335 G1198A unknown Het
Zfp568 A T 7: 30,022,256 I209F possibly damaging Het
Zfp787 C A 7: 6,155,524 probably benign Het
Zfp974 A T 7: 27,910,438 Y621N possibly damaging Het
Zyg11b A G 4: 108,250,502 I493T possibly damaging Het
Other mutations in Dnajc25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02102:Dnajc25 APN 4 59017693 nonsense probably null
R0505:Dnajc25 UTSW 4 59020438 missense possibly damaging 0.87
R1195:Dnajc25 UTSW 4 59003415 missense probably damaging 1.00
R2437:Dnajc25 UTSW 4 59020234 missense probably damaging 1.00
R5689:Dnajc25 UTSW 4 59017716 missense probably damaging 0.99
R6023:Dnajc25 UTSW 4 59013752 missense possibly damaging 0.53
R6329:Dnajc25 UTSW 4 59013678 missense probably benign 0.33
R7398:Dnajc25 UTSW 4 59017824 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGTGTCAGAATGTCCTGAAGTTAC -3'
(R):5'- ACGCATCATGTGATACAGCAC -3'

Sequencing Primer
(F):5'- AATTTGGGGAATGCTTTTATTCTGTC -3'
(R):5'- TGTGATACAGCACAATGCATAATG -3'
Posted On2019-06-26