Incidental Mutation 'R7316:Wdr18'
ID567980
Institutional Source Beutler Lab
Gene Symbol Wdr18
Ensembl Gene ENSMUSG00000035754
Gene NameWD repeat domain 18
Synonyms2310012I10Rik
Accession Numbers

Ncbi RefSeq: NM_175450.4; MGI: 2158400

Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #R7316 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location79960152-79970203 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 79965225 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 157 (D157E)
Ref Sequence ENSEMBL: ENSMUSP00000041049 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045247]
Predicted Effect probably benign
Transcript: ENSMUST00000045247
AA Change: D157E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000041049
Gene: ENSMUSG00000035754
AA Change: D157E

DomainStartEndE-ValueType
Blast:WD40 27 66 3e-17 BLAST
WD40 70 107 1.48e1 SMART
WD40 110 149 1.24e-4 SMART
WD40 161 202 2.49e-1 SMART
WD40 205 243 2.05e1 SMART
WD40 258 297 2.32e-9 SMART
low complexity region 353 367 N/A INTRINSIC
Pfam:WD40_alt 383 429 4.3e-26 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(8) : Targeted(1) Gene trapped(7)

Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik A G 12: 55,304,644 D246G probably damaging Het
2810474O19Rik T C 6: 149,326,638 L394P probably damaging Het
4933434E20Rik G A 3: 90,061,713 M214I probably benign Het
Aadat G T 8: 60,526,634 G177C probably damaging Het
Adam4 T C 12: 81,419,724 I708V probably benign Het
Aip T C 19: 4,114,793 N264S probably benign Het
Alox8 A T 11: 69,186,238 D505E probably benign Het
Ap3d1 A T 10: 80,717,859 I518N probably damaging Het
Arf3 G A 15: 98,740,993 Q128* probably null Het
Asph A G 4: 9,537,746 V344A probably benign Het
Birc6 A T 17: 74,604,494 R1500S probably damaging Het
Bptf G A 11: 107,073,109 T1753I probably damaging Het
Bptf A T 11: 107,110,914 C457* probably null Het
Brpf3 T A 17: 28,814,686 I568N probably damaging Het
Btnl4 G C 17: 34,469,057 N582K probably benign Het
Camsap3 C A 8: 3,604,648 P773T possibly damaging Het
Capsl A T 15: 9,461,802 I95L probably benign Het
Cd96 T A 16: 46,069,653 M336L probably benign Het
Cdan1 A T 2: 120,728,332 probably null Het
Chd3 A T 11: 69,345,568 L1939Q probably damaging Het
Cngb3 A T 4: 19,425,599 Y469F probably benign Het
Cp T C 3: 19,972,752 L448P probably damaging Het
Csnk1g2 T C 10: 80,639,853 V418A possibly damaging Het
Dag1 A T 9: 108,209,502 S147T probably benign Het
Dnajc25 T A 4: 59,017,693 Y117* probably null Het
Dpysl2 A T 14: 66,862,595 M64K possibly damaging Het
Dus3l A G 17: 56,765,551 H38R possibly damaging Het
E330021D16Rik T C 6: 136,401,278 K185E possibly damaging Het
Eme2 G A 17: 24,894,866 R62W probably damaging Het
Enox1 A T 14: 77,720,858 M616L probably benign Het
Epb41l4b T A 4: 57,019,867 T708S probably benign Het
Fam71f2 A G 6: 29,286,102 M187V probably benign Het
Fat2 A T 11: 55,286,067 I1534N probably damaging Het
Fer1l5 A G 1: 36,418,116 T1649A probably benign Het
Fmo9 A G 1: 166,663,646 V421A probably benign Het
Fsip2 A C 2: 82,989,691 Y5256S possibly damaging Het
Gapvd1 G A 2: 34,704,669 L804F probably damaging Het
Gen1 A G 12: 11,241,469 V838A probably benign Het
Gnptab A T 10: 88,400,710 N59I probably damaging Het
Grm5 A G 7: 87,975,265 T347A probably benign Het
Gsdmc3 T C 15: 63,858,402 N438D possibly damaging Het
Hmcn1 A G 1: 150,732,946 L1495S probably damaging Het
Islr2 T C 9: 58,197,967 E714G probably damaging Het
Larp4 A T 15: 100,001,017 M430L probably benign Het
Lpcat2b A G 5: 107,433,113 I103V not run Het
Lrguk C T 6: 34,103,256 S1142F unknown Het
Lrit2 G T 14: 37,068,858 V165F probably damaging Het
Mast3 T A 8: 70,779,788 I1182F probably damaging Het
Mcm6 C T 1: 128,359,508 D20N probably damaging Het
Mief1 A G 15: 80,249,397 I218M probably damaging Het
Mmp2 A G 8: 92,840,410 T453A probably benign Het
Ms4a18 T A 19: 11,001,996 S219C probably damaging Het
Myo5c A T 9: 75,269,638 T622S probably benign Het
Neb A T 2: 52,271,438 M2114K possibly damaging Het
Nemp1 T A 10: 127,689,343 L122* probably null Het
Nkx2-1 T C 12: 56,534,798 N88S probably benign Het
Nr2c2 T A 6: 92,154,463 C202S probably damaging Het
Ntsr1 A C 2: 180,500,752 D112A probably damaging Het
Olfr114 A G 17: 37,590,135 S73P probably damaging Het
Olfr430 A T 1: 174,070,161 I288F probably benign Het
Olfr680-ps1 A T 7: 105,090,900 H246Q probably damaging Het
Osbp2 C A 11: 3,726,431 R73L probably damaging Het
Pbp2 T A 6: 135,309,832 E172D probably damaging Het
Pcdhgc3 T C 18: 37,808,448 I634T probably benign Het
Phyh A T 2: 4,936,044 K252* probably null Het
Plcb3 C T 19: 6,966,385 probably null Het
Ppargc1b T C 18: 61,307,838 S670G probably damaging Het
Ptprc T C 1: 138,064,771 Y1067C probably damaging Het
Pwwp2b A C 7: 139,256,224 E527A probably benign Het
Pzp T C 6: 128,513,773 D409G probably damaging Het
Rbfox2 A T 15: 77,132,729 N148K possibly damaging Het
Rps24 T C 14: 24,490,689 probably benign Het
Slc35e4 T C 11: 3,912,584 K202E probably damaging Het
Spata7 C T 12: 98,658,612 R258W probably damaging Het
Spen A T 4: 141,477,054 S1421T unknown Het
Svep1 T A 4: 58,068,763 I3008F possibly damaging Het
Tbc1d1 G T 5: 64,335,277 probably null Het
Thsd4 T A 9: 59,987,359 H772L probably benign Het
Tle1 T C 4: 72,118,292 I769V probably benign Het
Tm4sf19 T A 16: 32,407,648 S127T possibly damaging Het
Tmprss9 C A 10: 80,894,979 R780S probably benign Het
Tpp2 T C 1: 43,970,431 V475A probably benign Het
Ttc30a1 A T 2: 75,980,857 L294Q probably damaging Het
Ttn A T 2: 76,766,913 N19885K probably damaging Het
Ttn A G 2: 76,862,165 V471A Het
Tub A T 7: 109,030,171 T478S possibly damaging Het
Vmn2r88 A T 14: 51,414,255 Y342F Het
Xrra1 A T 7: 99,876,216 probably null Het
Zc3h4 G C 7: 16,435,335 G1198A unknown Het
Zfp568 A T 7: 30,022,256 I209F possibly damaging Het
Zfp787 C A 7: 6,155,524 probably benign Het
Zfp974 A T 7: 27,910,438 Y621N possibly damaging Het
Zyg11b A G 4: 108,250,502 I493T possibly damaging Het
Other mutations in Wdr18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01382:Wdr18 APN 10 79965272 missense probably damaging 1.00
IGL02812:Wdr18 APN 10 79961064 missense possibly damaging 0.68
IGL02949:Wdr18 APN 10 79965055 missense probably benign 0.00
R0066:Wdr18 UTSW 10 79961103 nonsense probably null
R0066:Wdr18 UTSW 10 79961103 nonsense probably null
R0244:Wdr18 UTSW 10 79966408 missense probably damaging 1.00
R0257:Wdr18 UTSW 10 79961119 splice site probably benign
R0377:Wdr18 UTSW 10 79967502 missense probably benign 0.40
R1844:Wdr18 UTSW 10 79966727 critical splice donor site probably null
R4179:Wdr18 UTSW 10 79965041 missense probably damaging 1.00
R4674:Wdr18 UTSW 10 79965235 missense probably benign
R5573:Wdr18 UTSW 10 79965038 missense probably benign
R6007:Wdr18 UTSW 10 79965343 missense possibly damaging 0.94
R6455:Wdr18 UTSW 10 79965281 missense probably damaging 1.00
R7042:Wdr18 UTSW 10 79966110 missense probably benign 0.22
R7223:Wdr18 UTSW 10 79960368 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGGGGATGGCAGTCATTTTG -3'
(R):5'- GTGGCTGCCAGGAATTCATG -3'

Sequencing Primer
(F):5'- CATTTTGTCTCAGCGGGCAAG -3'
(R):5'- CCAGGAATTCATGGGTCGAG -3'
Posted On2019-06-26