Incidental Mutation 'R0638:Vcam1'
ID56799
Institutional Source Beutler Lab
Gene Symbol Vcam1
Ensembl Gene ENSMUSG00000027962
Gene Namevascular cell adhesion molecule 1
SynonymsVcam-1, CD106
MMRRC Submission 038827-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.483) question?
Stock #R0638 (G1)
Quality Score188
Status Validated
Chromosome3
Chromosomal Location116109949-116129688 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 116117259 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 497 (K497E)
Ref Sequence ENSEMBL: ENSMUSP00000029574 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029574]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029574
AA Change: K497E

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000029574
Gene: ENSMUSG00000027962
AA Change: K497E

DomainStartEndE-ValueType
IG 32 113 2.41e-6 SMART
Pfam:C2-set 133 221 4.5e-27 PFAM
IGc2 237 298 2.09e-15 SMART
IGc2 326 390 8.38e-6 SMART
Pfam:C2-set 421 509 7.2e-26 PFAM
IGc2 525 586 7.35e-11 SMART
IG 608 686 2.25e-6 SMART
transmembrane domain 699 721 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197031
Meta Mutation Damage Score 0.382 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 93.5%
Validation Efficiency 99% (76/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Ig superfamily and encodes a cell surface sialoglycoprotein expressed by cytokine-activated endothelium. This type I membrane protein mediates leukocyte-endothelial cell adhesion and signal transduction, and may play a role in the development of artherosclerosis and rheumatoid arthritis. Three alternatively spliced transcripts encoding different isoforms have been described for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Most homozygous null mutants die by embryonic day 12.5 due to defective placenta and failure of chorion/allantois fusion, and heart developmental anomalies. Survivors are generally normal, but have high numbers of circulating blood mononuclear leukocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik T C 2: 111,200,418 E382G probably damaging Het
4932414N04Rik C A 2: 68,717,228 Q161K probably benign Het
Aatk A T 11: 120,009,922 L1216Q probably damaging Het
Aifm3 T C 16: 17,503,671 F463L possibly damaging Het
Antxr2 C T 5: 97,960,637 W338* probably null Het
Apc2 T C 10: 80,304,967 S219P probably damaging Het
Arfgap3 A T 15: 83,308,188 probably null Het
Arrdc5 A G 17: 56,300,020 V75A possibly damaging Het
Atg16l2 A T 7: 101,300,110 probably null Het
Cacna1i A G 15: 80,381,080 N1511S possibly damaging Het
Cad T C 5: 31,077,688 Y2095H probably damaging Het
Chia1 T C 3: 106,128,437 probably benign Het
Crybg2 A G 4: 134,074,454 D975G probably damaging Het
Dagla T C 19: 10,254,883 I480V probably damaging Het
Efl1 C T 7: 82,651,887 T33I probably damaging Het
Esp36 A G 17: 38,417,169 F74L probably benign Het
Faim T C 9: 98,992,096 probably benign Het
Fam83h G T 15: 76,003,927 H520Q probably benign Het
Fbn2 A T 18: 58,045,374 C1931S probably damaging Het
Frs3 A G 17: 47,701,656 D96G probably benign Het
Gbp4 A G 5: 105,121,840 M374T probably damaging Het
Gimap1 C T 6: 48,741,425 probably benign Het
Gm10010 A G 6: 128,200,613 noncoding transcript Het
Gm10355 T C 3: 101,306,898 noncoding transcript Het
Gmip C T 8: 69,811,445 probably benign Het
Gpc2 A T 5: 138,278,534 F110Y possibly damaging Het
Ifi44l C T 3: 151,762,759 V45M probably benign Het
Il15 T C 8: 82,343,261 E58G probably damaging Het
Kat2b T C 17: 53,644,743 probably benign Het
Kcnh7 C A 2: 62,777,510 V576L probably benign Het
Lrrc66 T A 5: 73,615,473 probably benign Het
Mical1 A G 10: 41,482,239 E416G probably benign Het
Mroh3 A G 1: 136,191,002 Y526H probably damaging Het
Mtx2 T C 2: 74,869,290 probably benign Het
Naip6 A T 13: 100,300,528 Y496N probably benign Het
Nfyc A G 4: 120,768,884 S73P probably benign Het
Olfr1418 C T 19: 11,855,123 V277M probably damaging Het
Olfr1418 A C 19: 11,855,368 V195G probably damaging Het
Olfr382 T A 11: 73,516,924 I92F probably damaging Het
Olfr810 T A 10: 129,791,232 D119V probably damaging Het
Olfr995 A G 2: 85,438,501 I219T probably benign Het
P2ry14 A G 3: 59,115,448 V206A probably benign Het
Polg G A 7: 79,460,148 probably benign Het
Ptgs1 G A 2: 36,240,856 probably benign Het
Pus7l A G 15: 94,523,417 S671P probably benign Het
Ralgapa2 T C 2: 146,342,192 T1547A probably benign Het
Rif1 T C 2: 52,111,588 S1685P probably benign Het
Rnf213 T C 11: 119,470,210 Y4452H probably damaging Het
Samd7 A G 3: 30,756,521 D229G probably benign Het
Serpina3j T C 12: 104,314,819 S84P possibly damaging Het
Slc35d1 A G 4: 103,213,244 probably benign Het
Sorbs2 A G 8: 45,796,310 D847G probably damaging Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Steap4 T C 5: 7,977,030 probably benign Het
Tg A C 15: 66,717,208 T13P probably damaging Het
Timeless T A 10: 128,244,673 Y474* probably null Het
Tmem94 T C 11: 115,792,060 probably null Het
Trdmt1 G A 2: 13,516,648 probably benign Het
Trim23 T C 13: 104,201,309 Y522H probably benign Het
Ttc13 A T 8: 124,674,366 S624T probably damaging Het
Txnl1 A G 18: 63,692,064 probably benign Het
Unkl T C 17: 25,208,083 probably benign Het
Usp54 T A 14: 20,589,369 probably benign Het
Vmn1r49 C A 6: 90,072,666 S118I possibly damaging Het
Vmn2r118 T C 17: 55,608,466 K495E probably benign Het
Wrnip1 G A 13: 32,821,090 C560Y possibly damaging Het
Xkr5 T C 8: 18,933,547 R660G probably benign Het
Zfp280c A G X: 48,548,703 probably benign Het
Zfp707 G A 15: 75,975,129 A291T possibly damaging Het
Other mutations in Vcam1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00717:Vcam1 APN 3 116114471 missense possibly damaging 0.85
IGL01546:Vcam1 APN 3 116115942 missense possibly damaging 0.86
IGL01548:Vcam1 APN 3 116115951 missense probably benign 0.06
IGL02070:Vcam1 APN 3 116125997 missense probably benign 0.07
IGL02353:Vcam1 APN 3 116115894 missense possibly damaging 0.53
IGL02360:Vcam1 APN 3 116115894 missense possibly damaging 0.53
K7371:Vcam1 UTSW 3 116124649 missense probably benign 0.00
R0310:Vcam1 UTSW 3 116114416 missense possibly damaging 0.93
R0319:Vcam1 UTSW 3 116116060 missense probably benign 0.01
R0468:Vcam1 UTSW 3 116115946 nonsense probably null
R1070:Vcam1 UTSW 3 116110903 missense possibly damaging 0.96
R1728:Vcam1 UTSW 3 116114515 missense probably benign 0.16
R1784:Vcam1 UTSW 3 116114515 missense probably benign 0.16
R1956:Vcam1 UTSW 3 116125957 missense probably damaging 1.00
R1957:Vcam1 UTSW 3 116125957 missense probably damaging 1.00
R3052:Vcam1 UTSW 3 116124430 unclassified probably null
R3832:Vcam1 UTSW 3 116114491 missense possibly damaging 0.71
R4297:Vcam1 UTSW 3 116117243 missense probably benign
R4801:Vcam1 UTSW 3 116115935 missense probably damaging 0.98
R4802:Vcam1 UTSW 3 116115935 missense probably damaging 0.98
R4970:Vcam1 UTSW 3 116117292 missense probably benign 0.00
R5073:Vcam1 UTSW 3 116124388 missense probably damaging 1.00
R5074:Vcam1 UTSW 3 116124388 missense probably damaging 1.00
R5112:Vcam1 UTSW 3 116117292 missense probably benign 0.00
R5597:Vcam1 UTSW 3 116126002 missense probably damaging 0.99
R6035:Vcam1 UTSW 3 116125957 missense probably damaging 1.00
R6035:Vcam1 UTSW 3 116125957 missense probably damaging 1.00
R6120:Vcam1 UTSW 3 116124400 missense probably damaging 0.99
R6617:Vcam1 UTSW 3 116126062 missense possibly damaging 0.48
R7232:Vcam1 UTSW 3 116125979 missense possibly damaging 0.71
R7350:Vcam1 UTSW 3 116114562 missense probably damaging 0.99
R7384:Vcam1 UTSW 3 116117228 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- GCTGACCCAGTCCTGAATGCTAATG -3'
(R):5'- TGTCACTGTCAACTGCACAGTCCC -3'

Sequencing Primer
(F):5'- tcctgaatgctaatgcatagaatc -3'
(R):5'- AACTGCACAGTCCCTAATGTGTATC -3'
Posted On2013-07-11