Incidental Mutation 'R7316:Adam4'
ID567996
Institutional Source Beutler Lab
Gene Symbol Adam4
Ensembl Gene ENSMUSG00000072972
Gene Namea disintegrin and metallopeptidase domain 4
SynonymstMDCV
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R7316 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location81419443-81421946 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 81419724 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 708 (I708V)
Ref Sequence ENSEMBL: ENSMUSP00000082427 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085319] [ENSMUST00000110340] [ENSMUST00000164386] [ENSMUST00000166723]
Predicted Effect probably benign
Transcript: ENSMUST00000085319
AA Change: I708V

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000082427
Gene: ENSMUSG00000072972
AA Change: I708V

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:Pep_M12B_propep 46 163 9e-19 PFAM
Pfam:Reprolysin 213 406 1.3e-16 PFAM
DISIN 429 504 4.89e-37 SMART
ACR 505 648 2.28e-57 SMART
transmembrane domain 718 740 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110340
SMART Domains Protein: ENSMUSP00000105969
Gene: ENSMUSG00000091803

DomainStartEndE-ValueType
Pfam:COX16 16 74 6.6e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164386
SMART Domains Protein: ENSMUSP00000132941
Gene: ENSMUSG00000021139

DomainStartEndE-ValueType
PDZ 21 100 6.16e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166723
SMART Domains Protein: ENSMUSP00000130935
Gene: ENSMUSG00000091803

DomainStartEndE-ValueType
Pfam:COX16 16 73 6.9e-16 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik A G 12: 55,304,644 D246G probably damaging Het
2810474O19Rik T C 6: 149,326,638 L394P probably damaging Het
4933434E20Rik G A 3: 90,061,713 M214I probably benign Het
Aadat G T 8: 60,526,634 G177C probably damaging Het
Aip T C 19: 4,114,793 N264S probably benign Het
Alox8 A T 11: 69,186,238 D505E probably benign Het
Ap3d1 A T 10: 80,717,859 I518N probably damaging Het
Arf3 G A 15: 98,740,993 Q128* probably null Het
Asph A G 4: 9,537,746 V344A probably benign Het
Birc6 A T 17: 74,604,494 R1500S probably damaging Het
Bptf G A 11: 107,073,109 T1753I probably damaging Het
Bptf A T 11: 107,110,914 C457* probably null Het
Brpf3 T A 17: 28,814,686 I568N probably damaging Het
Btnl4 G C 17: 34,469,057 N582K probably benign Het
Camsap3 C A 8: 3,604,648 P773T possibly damaging Het
Capsl A T 15: 9,461,802 I95L probably benign Het
Cd96 T A 16: 46,069,653 M336L probably benign Het
Cdan1 A T 2: 120,728,332 probably null Het
Chd3 A T 11: 69,345,568 L1939Q probably damaging Het
Cngb3 A T 4: 19,425,599 Y469F probably benign Het
Cp T C 3: 19,972,752 L448P probably damaging Het
Csnk1g2 T C 10: 80,639,853 V418A possibly damaging Het
Dag1 A T 9: 108,209,502 S147T probably benign Het
Dnajc25 T A 4: 59,017,693 Y117* probably null Het
Dpysl2 A T 14: 66,862,595 M64K possibly damaging Het
Dus3l A G 17: 56,765,551 H38R possibly damaging Het
E330021D16Rik T C 6: 136,401,278 K185E possibly damaging Het
Eme2 G A 17: 24,894,866 R62W probably damaging Het
Enox1 A T 14: 77,720,858 M616L probably benign Het
Epb41l4b T A 4: 57,019,867 T708S probably benign Het
Fam71f2 A G 6: 29,286,102 M187V probably benign Het
Fat2 A T 11: 55,286,067 I1534N probably damaging Het
Fer1l5 A G 1: 36,418,116 T1649A probably benign Het
Fmo9 A G 1: 166,663,646 V421A probably benign Het
Fsip2 A C 2: 82,989,691 Y5256S possibly damaging Het
Gapvd1 G A 2: 34,704,669 L804F probably damaging Het
Gen1 A G 12: 11,241,469 V838A probably benign Het
Gnptab A T 10: 88,400,710 N59I probably damaging Het
Grm5 A G 7: 87,975,265 T347A probably benign Het
Gsdmc3 T C 15: 63,858,402 N438D possibly damaging Het
Hmcn1 A G 1: 150,732,946 L1495S probably damaging Het
Islr2 T C 9: 58,197,967 E714G probably damaging Het
Larp4 A T 15: 100,001,017 M430L probably benign Het
Lpcat2b A G 5: 107,433,113 I103V not run Het
Lrguk C T 6: 34,103,256 S1142F unknown Het
Lrit2 G T 14: 37,068,858 V165F probably damaging Het
Mast3 T A 8: 70,779,788 I1182F probably damaging Het
Mcm6 C T 1: 128,359,508 D20N probably damaging Het
Mief1 A G 15: 80,249,397 I218M probably damaging Het
Mmp2 A G 8: 92,840,410 T453A probably benign Het
Ms4a18 T A 19: 11,001,996 S219C probably damaging Het
Myo5c A T 9: 75,269,638 T622S probably benign Het
Neb A T 2: 52,271,438 M2114K possibly damaging Het
Nemp1 T A 10: 127,689,343 L122* probably null Het
Nkx2-1 T C 12: 56,534,798 N88S probably benign Het
Nr2c2 T A 6: 92,154,463 C202S probably damaging Het
Ntsr1 A C 2: 180,500,752 D112A probably damaging Het
Olfr114 A G 17: 37,590,135 S73P probably damaging Het
Olfr430 A T 1: 174,070,161 I288F probably benign Het
Olfr680-ps1 A T 7: 105,090,900 H246Q probably damaging Het
Osbp2 C A 11: 3,726,431 R73L probably damaging Het
Pbp2 T A 6: 135,309,832 E172D probably damaging Het
Pcdhgc3 T C 18: 37,808,448 I634T probably benign Het
Phyh A T 2: 4,936,044 K252* probably null Het
Plcb3 C T 19: 6,966,385 probably null Het
Ppargc1b T C 18: 61,307,838 S670G probably damaging Het
Ptprc T C 1: 138,064,771 Y1067C probably damaging Het
Pwwp2b A C 7: 139,256,224 E527A probably benign Het
Pzp T C 6: 128,513,773 D409G probably damaging Het
Rbfox2 A T 15: 77,132,729 N148K possibly damaging Het
Rps24 T C 14: 24,490,689 probably benign Het
Slc35e4 T C 11: 3,912,584 K202E probably damaging Het
Spata7 C T 12: 98,658,612 R258W probably damaging Het
Spen A T 4: 141,477,054 S1421T unknown Het
Svep1 T A 4: 58,068,763 I3008F possibly damaging Het
Tbc1d1 G T 5: 64,335,277 probably null Het
Thsd4 T A 9: 59,987,359 H772L probably benign Het
Tle1 T C 4: 72,118,292 I769V probably benign Het
Tm4sf19 T A 16: 32,407,648 S127T possibly damaging Het
Tmprss9 C A 10: 80,894,979 R780S probably benign Het
Tpp2 T C 1: 43,970,431 V475A probably benign Het
Ttc30a1 A T 2: 75,980,857 L294Q probably damaging Het
Ttn A T 2: 76,766,913 N19885K probably damaging Het
Ttn A G 2: 76,862,165 V471A Het
Tub A T 7: 109,030,171 T478S possibly damaging Het
Vmn2r88 A T 14: 51,414,255 Y342F Het
Wdr18 C A 10: 79,965,225 D157E probably benign Het
Xrra1 A T 7: 99,876,216 probably null Het
Zc3h4 G C 7: 16,435,335 G1198A unknown Het
Zfp568 A T 7: 30,022,256 I209F possibly damaging Het
Zfp787 C A 7: 6,155,524 probably benign Het
Zfp974 A T 7: 27,910,438 Y621N possibly damaging Het
Zyg11b A G 4: 108,250,502 I493T possibly damaging Het
Other mutations in Adam4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:Adam4 APN 12 81420649 missense probably damaging 0.96
IGL01133:Adam4 APN 12 81421446 missense possibly damaging 0.53
IGL01636:Adam4 APN 12 81419949 missense possibly damaging 0.81
IGL02133:Adam4 APN 12 81420029 missense probably benign 0.37
IGL02137:Adam4 APN 12 81421103 missense possibly damaging 0.91
IGL02425:Adam4 APN 12 81421328 missense probably benign 0.07
IGL02686:Adam4 APN 12 81421674 missense possibly damaging 0.88
R0554:Adam4 UTSW 12 81421424 missense probably damaging 1.00
R0684:Adam4 UTSW 12 81419654 missense probably damaging 1.00
R1519:Adam4 UTSW 12 81420877 missense possibly damaging 0.67
R1636:Adam4 UTSW 12 81419690 missense probably damaging 0.98
R1795:Adam4 UTSW 12 81421294 missense probably benign 0.03
R1835:Adam4 UTSW 12 81419559 missense probably benign 0.00
R2158:Adam4 UTSW 12 81421763 missense probably damaging 1.00
R2393:Adam4 UTSW 12 81420711 missense probably benign 0.02
R2923:Adam4 UTSW 12 81420744 missense probably damaging 1.00
R3411:Adam4 UTSW 12 81419822 missense possibly damaging 0.64
R4159:Adam4 UTSW 12 81420032 missense probably damaging 0.99
R4509:Adam4 UTSW 12 81421747 nonsense probably null
R4673:Adam4 UTSW 12 81421761 missense possibly damaging 0.56
R4794:Adam4 UTSW 12 81421424 missense probably damaging 0.99
R5564:Adam4 UTSW 12 81419574 missense probably benign 0.00
R5774:Adam4 UTSW 12 81420686 missense probably damaging 1.00
R6054:Adam4 UTSW 12 81420054 missense probably damaging 0.99
R6722:Adam4 UTSW 12 81421454 missense probably damaging 1.00
R6857:Adam4 UTSW 12 81419949 missense possibly damaging 0.81
R7393:Adam4 UTSW 12 81419660 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACACATCATCGACAATTTCTTGTGG -3'
(R):5'- AAGATGTGTTGCTCATCCAACTTTG -3'

Sequencing Primer
(F):5'- CGACAATTTCTTGTGGTAATTGAC -3'
(R):5'- GTCACTGTGTTCGAGGAT -3'
Posted On2019-06-26