Incidental Mutation 'R7319:Herc6'
ID568053
Institutional Source Beutler Lab
Gene Symbol Herc6
Ensembl Gene ENSMUSG00000029798
Gene Namehect domain and RLD 6
SynonymsHerc5, 1700121D12Rik, CEB1, 2510038N07Rik, 4930427L17Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7319 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location57581000-57664632 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 57604089 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 258 (T258K)
Ref Sequence ENSEMBL: ENSMUSP00000031817 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031817]
Predicted Effect probably damaging
Transcript: ENSMUST00000031817
AA Change: T258K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031817
Gene: ENSMUSG00000029798
AA Change: T258K

DomainStartEndE-ValueType
Pfam:RCC1 40 89 1.9e-12 PFAM
Pfam:RCC1 92 142 4.8e-17 PFAM
Pfam:RCC1_2 129 158 3.4e-14 PFAM
Pfam:RCC1 145 195 1.6e-18 PFAM
Pfam:RCC1_2 183 211 1e-8 PFAM
Pfam:RCC1 198 250 2e-10 PFAM
Pfam:RCC1_2 237 266 4e-10 PFAM
Pfam:RCC1 253 301 4.8e-9 PFAM
low complexity region 359 373 N/A INTRINSIC
low complexity region 611 626 N/A INTRINSIC
HECTc 677 1003 1.03e-57 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HERC6 belongs to the HERC family of ubiquitin ligases, all of which contain a HECT domain and at least 1 RCC1 (MIM 179710)-like domain (RLD). The 350-amino acid HECT domain is predicted to catalyze the formation of a thioester with ubiquitin before transferring it to a substrate, and the RLD is predicted to act as a guanine nucleotide exchange factor for small G proteins (Hochrainer et al., 2005 [PubMed 15676274]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik G A 5: 90,571,766 probably null Het
9930012K11Rik A T 14: 70,156,186 I287N probably benign Het
Aco2 G T 15: 81,903,619 E223D probably damaging Het
Acsf3 T A 8: 122,813,031 I466N probably damaging Het
Aox3 T A 1: 58,152,602 F438I probably benign Het
Arhgap33 T C 7: 30,526,369 T591A probably benign Het
Ash1l C T 3: 88,981,387 A191V probably benign Het
Btg2 T C 1: 134,079,041 K5E probably benign Het
C1galt1 T A 6: 7,871,150 Y329N probably damaging Het
C87499 G A 4: 88,629,947 P74S probably benign Het
Cacna1h A G 17: 25,389,461 I824T possibly damaging Het
Carmil3 A G 14: 55,494,360 I182V probably benign Het
Chek1 T A 9: 36,722,643 R129W probably damaging Het
Chrna6 A G 8: 27,406,787 M354T possibly damaging Het
Cpq A G 15: 33,250,039 T181A probably benign Het
Csmd2 A T 4: 128,393,679 Y1069F Het
Defb28 T A 2: 152,520,054 C45S possibly damaging Het
Dnah1 A G 14: 31,296,594 Y1360H probably benign Het
Dnah7c T A 1: 46,780,775 D3728E probably benign Het
Dnah7c T C 1: 46,784,448 V3749A possibly damaging Het
Dym G A 18: 75,063,174 probably null Het
Dzip3 A G 16: 48,927,540 probably null Het
Eef1akmt4 A G 16: 20,617,916 K163E probably benign Het
Fbrs A G 7: 127,482,813 T242A possibly damaging Het
Fgfr3 G A 5: 33,727,802 V87M possibly damaging Het
Fst A T 13: 114,458,532 C19S probably benign Het
Gm7276 G A 18: 77,185,520 R173W unknown Het
Gm9195 G A 14: 72,460,489 H1284Y probably benign Het
Gm9573 GGGGTGGGCATAGATCCTGAGGCAGAGCTGGATGCAGTGGTGGTCAGGGTGGG GGGGTGGG 17: 35,622,043 probably benign Het
Hip1r A G 5: 123,999,111 Y678C probably damaging Het
Ifne A T 4: 88,880,006 N58K probably damaging Het
Ighv1-26 A T 12: 114,788,543 H60Q possibly damaging Het
Ints1 A G 5: 139,760,765 F1276L probably damaging Het
Kcnc4 T A 3: 107,458,784 E36V probably benign Het
Kcnq2 C T 2: 181,109,102 G315S probably damaging Het
Kdm4c G A 4: 74,336,963 V585M probably damaging Het
Klhl26 C T 8: 70,452,942 R106H probably damaging Het
Kmo T C 1: 175,653,655 F313S probably damaging Het
Lmtk3 T A 7: 45,794,316 S808T unknown Het
Lrch3 A G 16: 32,994,993 T585A probably benign Het
Lrch4 T A 5: 137,639,715 H86Q Het
Map3k20 A G 2: 72,364,718 D113G probably damaging Het
Mbd3l1 T C 9: 18,485,121 S181P probably benign Het
Mccc2 T C 13: 99,967,733 T303A probably benign Het
Med27 A G 2: 29,413,478 R147G possibly damaging Het
Mrps5 T A 2: 127,595,842 S196R possibly damaging Het
Nudt2 A T 4: 41,477,575 M19L probably benign Het
Pcdha11 C T 18: 37,013,192 P779S probably benign Het
Phykpl A G 11: 51,598,703 T379A probably benign Het
Plekha8 A C 6: 54,624,221 M270L probably benign Het
Plekhg5 A G 4: 152,108,428 H593R probably benign Het
Polr2a T C 11: 69,746,370 N293S possibly damaging Het
Prex2 T A 1: 11,162,308 N866K probably benign Het
Psme4 A T 11: 30,807,790 I308L probably benign Het
Ptprb T C 10: 116,341,404 V1003A probably benign Het
Rbbp8 T A 18: 11,732,212 D719E probably damaging Het
Rnaset2b A T 17: 6,991,767 D144V probably benign Het
Senp6 T G 9: 80,126,199 D662E probably damaging Het
Serpinb3c T C 1: 107,273,087 N200S possibly damaging Het
Serpinb9g C G 13: 33,488,560 Y113* probably null Het
Sgf29 T C 7: 126,671,649 I134T probably benign Het
Ssfa2 A T 2: 79,636,072 D82V probably damaging Het
Stab1 G A 14: 31,140,826 L2243F probably damaging Het
Sympk T C 7: 19,035,845 V149A probably benign Het
Syt3 C T 7: 44,392,529 Q271* probably null Het
Tas2r109 A G 6: 132,980,700 I89T probably benign Het
Tgif1 A G 17: 70,844,852 S255P probably damaging Het
Tnf A G 17: 35,200,371 F161S possibly damaging Het
Topaz1 T A 9: 122,750,363 S779R possibly damaging Het
Topors A G 4: 40,260,540 S915P unknown Het
Tpm4 C T 8: 72,146,477 L161F probably damaging Het
Trim38 C T 13: 23,791,401 T441I probably damaging Het
Trpv1 A G 11: 73,250,794 M548V probably benign Het
Vmn2r68 T A 7: 85,233,834 T237S probably benign Het
Wdr34 G A 2: 30,038,329 P95L probably benign Het
Zc3hav1 A G 6: 38,332,274 S538P probably benign Het
Zfp541 C T 7: 16,079,369 T649I probably benign Het
Other mutations in Herc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Herc6 APN 6 57607145 missense probably benign 0.03
IGL00836:Herc6 APN 6 57619549 missense probably damaging 0.98
IGL01289:Herc6 APN 6 57598623 missense probably damaging 1.00
IGL01631:Herc6 APN 6 57604107 missense probably benign 0.03
IGL02656:Herc6 APN 6 57611836 critical splice donor site probably null
IGL02966:Herc6 APN 6 57583333 critical splice donor site probably null
IGL03297:Herc6 APN 6 57662389 missense probably benign 0.03
IGL02835:Herc6 UTSW 6 57646161 missense possibly damaging 0.94
R0218:Herc6 UTSW 6 57619601 missense probably benign 0.00
R0470:Herc6 UTSW 6 57619452 missense probably damaging 1.00
R0699:Herc6 UTSW 6 57581107 missense probably damaging 1.00
R0702:Herc6 UTSW 6 57581107 missense probably damaging 1.00
R0707:Herc6 UTSW 6 57662362 missense possibly damaging 0.81
R0850:Herc6 UTSW 6 57583242 missense possibly damaging 0.84
R1067:Herc6 UTSW 6 57662219 missense probably damaging 1.00
R1740:Herc6 UTSW 6 57652065 missense probably benign
R1840:Herc6 UTSW 6 57658106 nonsense probably null
R1889:Herc6 UTSW 6 57662075 nonsense probably null
R1938:Herc6 UTSW 6 57625941 missense probably damaging 1.00
R2024:Herc6 UTSW 6 57583332 missense probably benign 0.04
R2051:Herc6 UTSW 6 57625976 missense probably benign 0.00
R2238:Herc6 UTSW 6 57654401 missense probably benign 0.05
R2244:Herc6 UTSW 6 57598617 nonsense probably null
R4085:Herc6 UTSW 6 57647069 missense probably benign 0.09
R4410:Herc6 UTSW 6 57659679 missense possibly damaging 0.82
R4490:Herc6 UTSW 6 57654495 missense probably damaging 1.00
R4599:Herc6 UTSW 6 57659713 missense probably benign 0.34
R4716:Herc6 UTSW 6 57598438 missense probably damaging 1.00
R4757:Herc6 UTSW 6 57600060 critical splice donor site probably null
R4761:Herc6 UTSW 6 57662900 missense probably benign 0.01
R4798:Herc6 UTSW 6 57604166 missense probably damaging 1.00
R4826:Herc6 UTSW 6 57647087 missense probably benign 0.00
R5520:Herc6 UTSW 6 57647120 missense possibly damaging 0.51
R5545:Herc6 UTSW 6 57658007 critical splice acceptor site probably null
R5664:Herc6 UTSW 6 57618684 missense probably benign
R5763:Herc6 UTSW 6 57662887 missense probably damaging 1.00
R5916:Herc6 UTSW 6 57646203 missense probably benign
R6115:Herc6 UTSW 6 57583206 missense probably benign 0.01
R6225:Herc6 UTSW 6 57662154 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- GCATGAGGTTAATTAGTCTCATCAAC -3'
(R):5'- GTTTTGGGGTTTCTAAGTAATAAGCAC -3'

Sequencing Primer
(F):5'- atGGAAATTTATCCCATAAATCA -3'
(R):5'- GGGTTTCTAAGTAATAAGCACAAAAC -3'
Posted On2019-06-26