Incidental Mutation 'R7322:Klb'
ID568209
Institutional Source Beutler Lab
Gene Symbol Klb
Ensembl Gene ENSMUSG00000029195
Gene Nameklotho beta
SynonymsbetaKlotho
Accession Numbers

Genbank: NM_031180.2; Ensembl: ENSMUST00000031096;

MGI:1932466

Is this an essential gene? Possibly non essential (E-score: 0.382) question?
Stock #R7322 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location65348314-65384007 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 65383364 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 933 (E933D)
Ref Sequence ENSEMBL: ENSMUSP00000031096 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031096] [ENSMUST00000057885] [ENSMUST00000118543] [ENSMUST00000127874] [ENSMUST00000205084]
Predicted Effect probably benign
Transcript: ENSMUST00000031096
AA Change: E933D

PolyPhen 2 Score 0.440 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000031096
Gene: ENSMUSG00000029195
AA Change: E933D

DomainStartEndE-ValueType
Pfam:Glyco_hydro_1 77 385 8.8e-96 PFAM
Pfam:Glyco_hydro_1 374 506 1.7e-31 PFAM
Pfam:Glyco_hydro_1 515 965 6.3e-80 PFAM
transmembrane domain 995 1017 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000057885
SMART Domains Protein: ENSMUSP00000109399
Gene: ENSMUSG00000047215

DomainStartEndE-ValueType
Pfam:Ribosomal_L6 12 87 8.1e-18 PFAM
Pfam:Ribosomal_L6 99 178 7.4e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118543
SMART Domains Protein: ENSMUSP00000113391
Gene: ENSMUSG00000047215

DomainStartEndE-ValueType
Pfam:Ribosomal_L6 12 87 1.1e-19 PFAM
Pfam:Ribosomal_L6 99 165 1.5e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127874
SMART Domains Protein: ENSMUSP00000115577
Gene: ENSMUSG00000047215

DomainStartEndE-ValueType
Pfam:Ribosomal_L6 12 80 3.2e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150815
Predicted Effect probably benign
Transcript: ENSMUST00000205084
SMART Domains Protein: ENSMUSP00000145091
Gene: ENSMUSG00000029195

DomainStartEndE-ValueType
Pfam:Glyco_hydro_1 77 360 8.6e-94 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype Strain: 3587748
PHENOTYPE: Homozygous null mice display increased bile acid synthesis and excretion, resistance to gallstone formation, and slightly decreased body weight. Mice homozygous for a knock-out allele or a conditional allele activated in adipose tissue exhibit resistanceto FGF21-induced metabolic disruptions. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted(2) Gene trapped(3)

Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A T 4: 53,067,151 V1352D probably damaging Het
Adam33 C T 2: 131,053,694 C567Y probably damaging Het
Alppl2 C A 1: 87,087,462 G422C probably benign Het
Ang T A 14: 51,101,411 I3K unknown Het
Ankrd10 A T 8: 11,615,841 V253E probably damaging Het
Arhgef17 T C 7: 100,877,797 I806V probably benign Het
Atp10b T C 11: 43,212,547 L586P probably damaging Het
Bdkrb1 T C 12: 105,604,304 V43A possibly damaging Het
Brinp3 C T 1: 146,682,688 R117* probably null Het
Brwd1 A T 16: 96,066,119 M172K probably damaging Het
Bsn G A 9: 108,126,421 R262* probably null Het
Bst2 A C 8: 71,537,207 L74R probably damaging Het
C1qa T C 4: 136,896,154 *246W probably null Het
Cadm2 G A 16: 66,882,846 T42M probably damaging Het
Ccdc150 A G 1: 54,259,966 T34A probably benign Het
Ccdc178 G A 18: 22,105,549 T337M probably benign Het
Ccl8 T C 11: 82,116,582 V81A probably damaging Het
Dgcr6 A G 16: 18,070,907 T69A unknown Het
Dnah10 A G 5: 124,821,269 D3762G probably benign Het
Eif3d T C 15: 77,961,676 T382A probably benign Het
Epb41 A T 4: 131,989,719 Y375N probably damaging Het
Epb41l1 A T 2: 156,503,851 H258L probably damaging Het
Fbn1 A C 2: 125,479,195 I81S possibly damaging Het
Fzd5 A G 1: 64,735,328 S425P probably damaging Het
Gfra2 T A 14: 70,968,391 V398D probably benign Het
Gm3755 A G 14: 7,448,178 L130P Het
Grin3b A G 10: 79,975,695 Y705C probably damaging Het
Hmcn2 A G 2: 31,459,081 D4944G probably damaging Het
Hoxd11 T C 2: 74,684,011 L295P probably damaging Het
Ighv1-81 C A 12: 115,920,667 G16C possibly damaging Het
Kcna5 T C 6: 126,533,791 D458G possibly damaging Het
Lrp1 A T 10: 127,545,564 M3855K probably benign Het
Map3k4 A T 17: 12,270,946 L533I probably damaging Het
Mrps6 C A 16: 92,058,447 Y4* probably null Het
Nabp1 A T 1: 51,473,070 V105E probably damaging Het
Naip6 T A 13: 100,299,388 N876Y possibly damaging Het
Nlrp2 T C 7: 5,308,645 S944G possibly damaging Het
Nr4a3 A T 4: 48,083,238 E590D probably benign Het
Olfr1054 C T 2: 86,332,564 S264N probably benign Het
Olfr1106 A T 2: 87,048,479 Y252* probably null Het
Olfr1564 A G 17: 33,215,699 I215T probably damaging Het
Olfr362 T C 2: 37,105,591 R20G probably null Het
Olfr597 T A 7: 103,321,287 V292E Het
Pcp4l1 G A 1: 171,174,465 A42V possibly damaging Het
Pdzd2 T C 15: 12,437,162 D451G probably damaging Het
Pkd2l1 A G 19: 44,157,690 S142P probably benign Het
Postn T C 3: 54,370,280 L232P probably damaging Het
Prss8 T C 7: 127,929,563 T33A probably benign Het
Rapgef2 A T 3: 79,145,823 M1K probably null Het
Rasa3 T C 8: 13,595,857 N161S possibly damaging Het
Riox1 G A 12: 83,950,668 probably benign Het
Rmdn2 A T 17: 79,621,611 K97N probably damaging Het
Sgo1 A G 17: 53,677,057 L431P probably damaging Het
Slc9a8 T A 2: 167,451,302 V217E probably damaging Het
Slco2b1 C T 7: 99,691,848 G21D not run Het
Spata31d1d C A 13: 59,726,976 R915L probably benign Het
Stk17b A T 1: 53,765,945 N152K probably benign Het
Syne2 T A 12: 75,984,024 I3634N probably damaging Het
Tnfrsf9 A G 4: 150,934,337 D155G probably damaging Het
Tnrc6a T A 7: 123,171,508 D840E probably benign Het
Tyk2 G A 9: 21,110,204 S902L probably benign Het
Unc119 T C 11: 78,348,623 S235P probably damaging Het
Vav1 A C 17: 57,302,266 D394A probably benign Het
Vezf1 T A 11: 88,081,584 I439K possibly damaging Het
Zadh2 A G 18: 84,095,135 Y312C probably damaging Het
Zfp335 A T 2: 164,910,821 M1K probably null Het
Zfp715 T C 7: 43,311,138 T10A possibly damaging Het
Zmynd11 C T 13: 9,690,409 E382K possibly damaging Het
Other mutations in Klb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Klb APN 5 65372374 missense possibly damaging 0.90
IGL00821:Klb APN 5 65372149 missense probably damaging 1.00
IGL01082:Klb APN 5 65375940 missense possibly damaging 0.71
IGL01637:Klb APN 5 65375679 critical splice acceptor site probably null
IGL02098:Klb APN 5 65379885 missense probably benign 0.21
IGL03113:Klb APN 5 65383470 missense probably benign 0.00
1mM(1):Klb UTSW 5 65348650 missense probably damaging 1.00
P0016:Klb UTSW 5 65379923 nonsense probably null
R0268:Klb UTSW 5 65348837 missense probably benign 0.02
R0383:Klb UTSW 5 65372499 intron probably null
R0676:Klb UTSW 5 65379055 missense probably damaging 1.00
R0735:Klb UTSW 5 65379727 missense probably benign
R0972:Klb UTSW 5 65348746 missense possibly damaging 0.70
R1051:Klb UTSW 5 65379327 missense probably damaging 1.00
R1168:Klb UTSW 5 65378974 missense probably damaging 1.00
R1372:Klb UTSW 5 65348746 missense possibly damaging 0.70
R1403:Klb UTSW 5 65348746 missense possibly damaging 0.70
R1403:Klb UTSW 5 65348746 missense possibly damaging 0.70
R1446:Klb UTSW 5 65348995 missense probably damaging 1.00
R1696:Klb UTSW 5 65348746 missense possibly damaging 0.70
R1743:Klb UTSW 5 65375861 missense probably damaging 0.99
R1801:Klb UTSW 5 65349235 missense probably null 0.90
R1804:Klb UTSW 5 65379853 missense probably damaging 1.00
R1848:Klb UTSW 5 65348837 missense probably benign 0.02
R1967:Klb UTSW 5 65372074 missense probably damaging 0.98
R3420:Klb UTSW 5 65372142 missense probably damaging 1.00
R4397:Klb UTSW 5 65380039 missense probably damaging 1.00
R4490:Klb UTSW 5 65375794 missense probably benign 0.02
R4491:Klb UTSW 5 65375794 missense probably benign 0.02
R4547:Klb UTSW 5 65379928 missense probably benign 0.00
R4878:Klb UTSW 5 65348490 missense probably damaging 0.99
R5269:Klb UTSW 5 65348797 missense probably damaging 1.00
R5418:Klb UTSW 5 65383470 missense probably benign 0.00
R5453:Klb UTSW 5 65383385 missense probably benign 0.08
R5541:Klb UTSW 5 65379234 missense probably benign 0.27
R5672:Klb UTSW 5 65379949 missense possibly damaging 0.82
R5841:Klb UTSW 5 65379324 nonsense probably null
R6088:Klb UTSW 5 65349013 missense probably benign 0.07
R6807:Klb UTSW 5 65379534 missense probably damaging 1.00
R6955:Klb UTSW 5 65379088 nonsense probably null
R7068:Klb UTSW 5 65379340 missense probably damaging 1.00
R7284:Klb UTSW 5 65383478 missense probably benign 0.01
R7346:Klb UTSW 5 65348631 nonsense probably null
R7366:Klb UTSW 5 65372431 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATCTTCAATGAGAATCATGACTTCA -3'
(R):5'- CCACGAGAAATGAGCAAATGGT -3'

Sequencing Primer
(F):5'- AGGGCATTGGATCCCATTAC -3'
(R):5'- CAAATGGTGCAGTCTGTGTCTTCC -3'
Posted On2019-06-26