Incidental Mutation 'R7322:Rasa3'
ID568220
Institutional Source Beutler Lab
Gene Symbol Rasa3
Ensembl Gene ENSMUSG00000031453
Gene NameRAS p21 protein activator 3
SynonymsGAPIII, R-Ras gap, Ras GTPase-activating protein III, GAPIII activator 3, scat
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7322 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location13566948-13677603 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 13595857 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 161 (N161S)
Ref Sequence ENSEMBL: ENSMUSP00000112998 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117551] [ENSMUST00000154454]
Predicted Effect possibly damaging
Transcript: ENSMUST00000117551
AA Change: N161S

PolyPhen 2 Score 0.456 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000112998
Gene: ENSMUSG00000031453
AA Change: N161S

DomainStartEndE-ValueType
C2 13 111 2.29e-15 SMART
C2 146 262 1.03e-17 SMART
RasGAP 275 614 3.96e-166 SMART
PH 577 679 5.53e-16 SMART
BTK 679 715 9.16e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154454
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that binds inositol 1,3,4,5-tetrakisphosphate and stimulates the GTPase activity of Ras p21. This protein functions as a negative regulator of the Ras signalling pathway. It is localized to the cell membrane via a pleckstrin homology (PH) domain in the C-terminal region. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a targeted null mutation die at E12.5-13.5 of massive subcutaneous and intraparenchymal hemorrhage, probably due to underdeveloped adherens junctions between capillary endothelial cells. At E12.5, edema and severe hemorrhaging is frequently observed in the brain and/or rump. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A T 4: 53,067,151 V1352D probably damaging Het
Adam33 C T 2: 131,053,694 C567Y probably damaging Het
Alppl2 C A 1: 87,087,462 G422C probably benign Het
Ang T A 14: 51,101,411 I3K unknown Het
Ankrd10 A T 8: 11,615,841 V253E probably damaging Het
Arhgef17 T C 7: 100,877,797 I806V probably benign Het
Atp10b T C 11: 43,212,547 L586P probably damaging Het
Bdkrb1 T C 12: 105,604,304 V43A possibly damaging Het
Brinp3 C T 1: 146,682,688 R117* probably null Het
Brwd1 A T 16: 96,066,119 M172K probably damaging Het
Bsn G A 9: 108,126,421 R262* probably null Het
Bst2 A C 8: 71,537,207 L74R probably damaging Het
C1qa T C 4: 136,896,154 *246W probably null Het
Cadm2 G A 16: 66,882,846 T42M probably damaging Het
Ccdc150 A G 1: 54,259,966 T34A probably benign Het
Ccdc178 G A 18: 22,105,549 T337M probably benign Het
Ccl8 T C 11: 82,116,582 V81A probably damaging Het
Dgcr6 A G 16: 18,070,907 T69A unknown Het
Dnah10 A G 5: 124,821,269 D3762G probably benign Het
Eif3d T C 15: 77,961,676 T382A probably benign Het
Epb41 A T 4: 131,989,719 Y375N probably damaging Het
Epb41l1 A T 2: 156,503,851 H258L probably damaging Het
Fbn1 A C 2: 125,479,195 I81S possibly damaging Het
Fzd5 A G 1: 64,735,328 S425P probably damaging Het
Gfra2 T A 14: 70,968,391 V398D probably benign Het
Gm3755 A G 14: 7,448,178 L130P Het
Grin3b A G 10: 79,975,695 Y705C probably damaging Het
Hmcn2 A G 2: 31,459,081 D4944G probably damaging Het
Hoxd11 T C 2: 74,684,011 L295P probably damaging Het
Ighv1-81 C A 12: 115,920,667 G16C possibly damaging Het
Kcna5 T C 6: 126,533,791 D458G possibly damaging Het
Klb A T 5: 65,383,364 E933D probably benign Het
Lrp1 A T 10: 127,545,564 M3855K probably benign Het
Map3k4 A T 17: 12,270,946 L533I probably damaging Het
Mrps6 C A 16: 92,058,447 Y4* probably null Het
Nabp1 A T 1: 51,473,070 V105E probably damaging Het
Naip6 T A 13: 100,299,388 N876Y possibly damaging Het
Nlrp2 T C 7: 5,308,645 S944G possibly damaging Het
Nr4a3 A T 4: 48,083,238 E590D probably benign Het
Olfr1054 C T 2: 86,332,564 S264N probably benign Het
Olfr1106 A T 2: 87,048,479 Y252* probably null Het
Olfr1564 A G 17: 33,215,699 I215T probably damaging Het
Olfr362 T C 2: 37,105,591 R20G probably null Het
Olfr597 T A 7: 103,321,287 V292E Het
Pcp4l1 G A 1: 171,174,465 A42V possibly damaging Het
Pdzd2 T C 15: 12,437,162 D451G probably damaging Het
Pkd2l1 A G 19: 44,157,690 S142P probably benign Het
Postn T C 3: 54,370,280 L232P probably damaging Het
Prss8 T C 7: 127,929,563 T33A probably benign Het
Rapgef2 A T 3: 79,145,823 M1K probably null Het
Riox1 G A 12: 83,950,668 probably benign Het
Rmdn2 A T 17: 79,621,611 K97N probably damaging Het
Sgo1 A G 17: 53,677,057 L431P probably damaging Het
Slc9a8 T A 2: 167,451,302 V217E probably damaging Het
Slco2b1 C T 7: 99,691,848 G21D not run Het
Spata31d1d C A 13: 59,726,976 R915L probably benign Het
Stk17b A T 1: 53,765,945 N152K probably benign Het
Syne2 T A 12: 75,984,024 I3634N probably damaging Het
Tnfrsf9 A G 4: 150,934,337 D155G probably damaging Het
Tnrc6a T A 7: 123,171,508 D840E probably benign Het
Tyk2 G A 9: 21,110,204 S902L probably benign Het
Unc119 T C 11: 78,348,623 S235P probably damaging Het
Vav1 A C 17: 57,302,266 D394A probably benign Het
Vezf1 T A 11: 88,081,584 I439K possibly damaging Het
Zadh2 A G 18: 84,095,135 Y312C probably damaging Het
Zfp335 A T 2: 164,910,821 M1K probably null Het
Zfp715 T C 7: 43,311,138 T10A possibly damaging Het
Zmynd11 C T 13: 9,690,409 E382K possibly damaging Het
Other mutations in Rasa3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Rasa3 APN 8 13595410 unclassified probably benign
IGL02112:Rasa3 APN 8 13585042 splice site probably benign
IGL02946:Rasa3 APN 8 13598280 missense probably benign 0.33
IGL03085:Rasa3 APN 8 13585690 missense probably benign 0.11
Box_canyon UTSW 8 13584959 nonsense probably null
Mount_ouray UTSW 8 13631811 missense possibly damaging 0.90
Poncha_pass UTSW 8 13595373 missense possibly damaging 0.46
Ute UTSW 8 13582381 splice site probably benign
PIT4531001:Rasa3 UTSW 8 13605887 missense probably benign 0.11
R0193:Rasa3 UTSW 8 13570233 splice site probably null
R0710:Rasa3 UTSW 8 13583830 missense probably damaging 1.00
R0726:Rasa3 UTSW 8 13580118 splice site probably benign
R1405:Rasa3 UTSW 8 13588027 missense possibly damaging 0.83
R1405:Rasa3 UTSW 8 13588027 missense possibly damaging 0.83
R1797:Rasa3 UTSW 8 13582372 missense probably benign 0.44
R1828:Rasa3 UTSW 8 13585035 missense probably benign 0.02
R1895:Rasa3 UTSW 8 13631768 splice site probably benign
R2090:Rasa3 UTSW 8 13582381 splice site probably benign
R2374:Rasa3 UTSW 8 13577411 missense probably damaging 1.00
R2655:Rasa3 UTSW 8 13595373 missense possibly damaging 0.46
R3703:Rasa3 UTSW 8 13588972 missense probably benign
R3899:Rasa3 UTSW 8 13578635 missense probably benign 0.21
R4230:Rasa3 UTSW 8 13570264 missense possibly damaging 0.47
R4256:Rasa3 UTSW 8 13614532 critical splice donor site probably null
R4281:Rasa3 UTSW 8 13588946 missense probably benign 0.01
R4498:Rasa3 UTSW 8 13614587 missense probably benign 0.01
R4558:Rasa3 UTSW 8 13598259 missense probably damaging 0.96
R4559:Rasa3 UTSW 8 13598259 missense probably damaging 0.96
R4647:Rasa3 UTSW 8 13588865 missense probably null 0.00
R4702:Rasa3 UTSW 8 13570394 missense probably benign 0.09
R4772:Rasa3 UTSW 8 13598289 missense probably damaging 1.00
R4774:Rasa3 UTSW 8 13577501 missense probably benign 0.07
R4807:Rasa3 UTSW 8 13614633 missense probably damaging 1.00
R5008:Rasa3 UTSW 8 13584959 nonsense probably null
R5043:Rasa3 UTSW 8 13570368 missense possibly damaging 0.59
R5352:Rasa3 UTSW 8 13631778 missense possibly damaging 0.88
R5435:Rasa3 UTSW 8 13631811 missense possibly damaging 0.90
R6207:Rasa3 UTSW 8 13598251 missense possibly damaging 0.67
R6733:Rasa3 UTSW 8 13580037 missense possibly damaging 0.88
R6855:Rasa3 UTSW 8 13585029 missense probably damaging 1.00
R7024:Rasa3 UTSW 8 13631826 missense probably benign 0.29
R7100:Rasa3 UTSW 8 13586897 missense probably benign 0.02
R7394:Rasa3 UTSW 8 13595353 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TCAAAGTATACCTGCCCTCCCG -3'
(R):5'- ACCTAGGTGCTTTGGAGAGG -3'

Sequencing Primer
(F):5'- CCAGAACTGAAACTGGCA -3'
(R):5'- CGTAGTTTGATGAAGGCCACC -3'
Posted On2019-06-26