Incidental Mutation 'R7322:Tyk2'
ID568222
Institutional Source Beutler Lab
Gene Symbol Tyk2
Ensembl Gene ENSMUSG00000032175
Gene Nametyrosine kinase 2
SynonymsJTK1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7322 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location21104068-21131243 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 21110204 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 902 (S902L)
Ref Sequence ENSEMBL: ENSMUSP00000150354 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001036] [ENSMUST00000214454] [ENSMUST00000216874]
Predicted Effect probably benign
Transcript: ENSMUST00000001036
AA Change: S902L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000001036
Gene: ENSMUSG00000032175
AA Change: S902L

DomainStartEndE-ValueType
B41 29 301 1.51e-26 SMART
Blast:B41 408 460 3e-12 BLAST
SH2 470 562 1.26e-2 SMART
STYKc 612 886 8.89e-15 SMART
TyrKc 917 1189 6.48e-114 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000214454
AA Change: S879L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000216874
AA Change: S902L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tyrosine kinase and, more specifically, the Janus kinases (JAKs) protein families. This protein associates with the cytoplasmic domain of type I and type II cytokine receptors and promulgate cytokine signals by phosphorylating receptor subunits. It is also component of both the type I and type III interferon signaling pathways. As such, it may play a role in anti-viral immunity. A mutation in this gene has been associated with hyperimmunoglobulin E syndrome (HIES) - a primary immunodeficiency characterized by elevated serum immunoglobulin E. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice are viable and fertile, but differ from wild-type with respect to interleukin 12 mediated T cell function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A T 4: 53,067,151 V1352D probably damaging Het
Adam33 C T 2: 131,053,694 C567Y probably damaging Het
Alppl2 C A 1: 87,087,462 G422C probably benign Het
Ang T A 14: 51,101,411 I3K unknown Het
Ankrd10 A T 8: 11,615,841 V253E probably damaging Het
Arhgef17 T C 7: 100,877,797 I806V probably benign Het
Atp10b T C 11: 43,212,547 L586P probably damaging Het
Bdkrb1 T C 12: 105,604,304 V43A possibly damaging Het
Brinp3 C T 1: 146,682,688 R117* probably null Het
Brwd1 A T 16: 96,066,119 M172K probably damaging Het
Bsn G A 9: 108,126,421 R262* probably null Het
Bst2 A C 8: 71,537,207 L74R probably damaging Het
C1qa T C 4: 136,896,154 *246W probably null Het
Cadm2 G A 16: 66,882,846 T42M probably damaging Het
Ccdc150 A G 1: 54,259,966 T34A probably benign Het
Ccdc178 G A 18: 22,105,549 T337M probably benign Het
Ccl8 T C 11: 82,116,582 V81A probably damaging Het
Dgcr6 A G 16: 18,070,907 T69A unknown Het
Dnah10 A G 5: 124,821,269 D3762G probably benign Het
Eif3d T C 15: 77,961,676 T382A probably benign Het
Epb41 A T 4: 131,989,719 Y375N probably damaging Het
Epb41l1 A T 2: 156,503,851 H258L probably damaging Het
Fbn1 A C 2: 125,479,195 I81S possibly damaging Het
Fzd5 A G 1: 64,735,328 S425P probably damaging Het
Gfra2 T A 14: 70,968,391 V398D probably benign Het
Gm3755 A G 14: 7,448,178 L130P Het
Grin3b A G 10: 79,975,695 Y705C probably damaging Het
Hmcn2 A G 2: 31,459,081 D4944G probably damaging Het
Hoxd11 T C 2: 74,684,011 L295P probably damaging Het
Ighv1-81 C A 12: 115,920,667 G16C possibly damaging Het
Kcna5 T C 6: 126,533,791 D458G possibly damaging Het
Klb A T 5: 65,383,364 E933D probably benign Het
Lrp1 A T 10: 127,545,564 M3855K probably benign Het
Map3k4 A T 17: 12,270,946 L533I probably damaging Het
Mrps6 C A 16: 92,058,447 Y4* probably null Het
Nabp1 A T 1: 51,473,070 V105E probably damaging Het
Naip6 T A 13: 100,299,388 N876Y possibly damaging Het
Nlrp2 T C 7: 5,308,645 S944G possibly damaging Het
Nr4a3 A T 4: 48,083,238 E590D probably benign Het
Olfr1054 C T 2: 86,332,564 S264N probably benign Het
Olfr1106 A T 2: 87,048,479 Y252* probably null Het
Olfr1564 A G 17: 33,215,699 I215T probably damaging Het
Olfr362 T C 2: 37,105,591 R20G probably null Het
Olfr597 T A 7: 103,321,287 V292E Het
Pcp4l1 G A 1: 171,174,465 A42V possibly damaging Het
Pdzd2 T C 15: 12,437,162 D451G probably damaging Het
Pkd2l1 A G 19: 44,157,690 S142P probably benign Het
Postn T C 3: 54,370,280 L232P probably damaging Het
Prss8 T C 7: 127,929,563 T33A probably benign Het
Rapgef2 A T 3: 79,145,823 M1K probably null Het
Rasa3 T C 8: 13,595,857 N161S possibly damaging Het
Riox1 G A 12: 83,950,668 probably benign Het
Rmdn2 A T 17: 79,621,611 K97N probably damaging Het
Sgo1 A G 17: 53,677,057 L431P probably damaging Het
Slc9a8 T A 2: 167,451,302 V217E probably damaging Het
Slco2b1 C T 7: 99,691,848 G21D not run Het
Spata31d1d C A 13: 59,726,976 R915L probably benign Het
Stk17b A T 1: 53,765,945 N152K probably benign Het
Syne2 T A 12: 75,984,024 I3634N probably damaging Het
Tnfrsf9 A G 4: 150,934,337 D155G probably damaging Het
Tnrc6a T A 7: 123,171,508 D840E probably benign Het
Unc119 T C 11: 78,348,623 S235P probably damaging Het
Vav1 A C 17: 57,302,266 D394A probably benign Het
Vezf1 T A 11: 88,081,584 I439K possibly damaging Het
Zadh2 A G 18: 84,095,135 Y312C probably damaging Het
Zfp335 A T 2: 164,910,821 M1K probably null Het
Zfp715 T C 7: 43,311,138 T10A possibly damaging Het
Zmynd11 C T 13: 9,690,409 E382K possibly damaging Het
Other mutations in Tyk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00980:Tyk2 APN 9 21120588 missense probably benign 0.27
IGL01015:Tyk2 APN 9 21120700 missense probably benign 0.00
IGL01096:Tyk2 APN 9 21108863 missense probably damaging 1.00
IGL01410:Tyk2 APN 9 21109364 missense probably damaging 1.00
IGL01613:Tyk2 APN 9 21120576 missense probably damaging 0.99
IGL01997:Tyk2 APN 9 21110494 missense probably damaging 1.00
IGL02249:Tyk2 APN 9 21120407 missense probably damaging 1.00
IGL02407:Tyk2 APN 9 21109227 splice site probably benign
IGL02538:Tyk2 APN 9 21111043 missense possibly damaging 0.94
IGL03185:Tyk2 APN 9 21109384 missense probably damaging 1.00
ANU74:Tyk2 UTSW 9 21116158 missense probably damaging 1.00
R0355:Tyk2 UTSW 9 21114190 splice site probably null
R0667:Tyk2 UTSW 9 21108871 missense probably damaging 1.00
R0862:Tyk2 UTSW 9 21116167 missense probably benign 0.00
R0883:Tyk2 UTSW 9 21111137 missense possibly damaging 0.61
R1554:Tyk2 UTSW 9 21107922 missense probably damaging 0.96
R1575:Tyk2 UTSW 9 21115462 missense probably benign 0.00
R1664:Tyk2 UTSW 9 21120353 missense probably damaging 1.00
R1676:Tyk2 UTSW 9 21115249 nonsense probably null
R1843:Tyk2 UTSW 9 21121554 nonsense probably null
R1871:Tyk2 UTSW 9 21121441 missense probably damaging 1.00
R2044:Tyk2 UTSW 9 21120341 missense probably damaging 1.00
R2137:Tyk2 UTSW 9 21110985 intron probably benign
R2197:Tyk2 UTSW 9 21115207 missense probably damaging 1.00
R2883:Tyk2 UTSW 9 21110587 missense probably benign 0.01
R2941:Tyk2 UTSW 9 21111119 missense probably benign 0.00
R3001:Tyk2 UTSW 9 21109321 missense probably benign 0.00
R3002:Tyk2 UTSW 9 21109321 missense probably benign 0.00
R3196:Tyk2 UTSW 9 21124032 missense possibly damaging 0.80
R3622:Tyk2 UTSW 9 21127310 missense probably damaging 0.98
R4024:Tyk2 UTSW 9 21115919 missense probably damaging 1.00
R4459:Tyk2 UTSW 9 21124415 missense probably damaging 1.00
R4604:Tyk2 UTSW 9 21108009 missense probably damaging 1.00
R4664:Tyk2 UTSW 9 21114207 missense probably damaging 0.99
R4666:Tyk2 UTSW 9 21114207 missense probably damaging 0.99
R4915:Tyk2 UTSW 9 21111137 missense probably benign 0.41
R4971:Tyk2 UTSW 9 21120501 critical splice donor site probably null
R5014:Tyk2 UTSW 9 21115830 splice site probably null
R5191:Tyk2 UTSW 9 21107497 missense probably damaging 0.98
R5305:Tyk2 UTSW 9 21109381 missense probably damaging 0.99
R5356:Tyk2 UTSW 9 21115744 missense probably benign 0.03
R5501:Tyk2 UTSW 9 21121612 missense probably damaging 1.00
R6025:Tyk2 UTSW 9 21115960 missense probably benign 0.05
R6113:Tyk2 UTSW 9 21107922 missense probably damaging 1.00
R6159:Tyk2 UTSW 9 21110504 missense probably damaging 0.99
R6608:Tyk2 UTSW 9 21108016 missense probably benign 0.02
R6610:Tyk2 UTSW 9 21108016 missense probably benign 0.02
R6612:Tyk2 UTSW 9 21108016 missense probably benign 0.02
R6870:Tyk2 UTSW 9 21124954 missense probably damaging 1.00
R7216:Tyk2 UTSW 9 21120526 missense probably benign 0.01
R7218:Tyk2 UTSW 9 21105054 missense probably damaging 1.00
R7298:Tyk2 UTSW 9 21108860 missense probably benign 0.35
R7347:Tyk2 UTSW 9 21108034 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCAGTTCTCCAAACCAGCC -3'
(R):5'- ACATCTAAGGTCTCTCCCTGG -3'

Sequencing Primer
(F):5'- TGCAGGCTCCATTCCATAGATCTAAG -3'
(R):5'- TCTCTCCCTGGGGCATG -3'
Posted On2019-06-26