Incidental Mutation 'R7322:Unc119'
ID568227
Institutional Source Beutler Lab
Gene Symbol Unc119
Ensembl Gene ENSMUSG00000002058
Gene Nameunc-119 lipid binding chaperone
SynonymsUNC119, Unc119h, MRG4, HRG4, Rtg4, Rg4
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7322 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location78343482-78349164 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 78348623 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 235 (S235P)
Ref Sequence ENSEMBL: ENSMUSP00000002127 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002127] [ENSMUST00000100755] [ENSMUST00000108295]
Predicted Effect probably damaging
Transcript: ENSMUST00000002127
AA Change: S235P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000002127
Gene: ENSMUSG00000002058
AA Change: S235P

DomainStartEndE-ValueType
low complexity region 6 13 N/A INTRINSIC
low complexity region 29 54 N/A INTRINSIC
Pfam:GMP_PDE_delta 78 237 1.6e-81 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000100755
AA Change: S170P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000098318
Gene: ENSMUSG00000002058
AA Change: S170P

DomainStartEndE-ValueType
Pfam:GMP_PDE_delta 13 172 1.6e-82 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108295
AA Change: S257P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103930
Gene: ENSMUSG00000002058
AA Change: S257P

DomainStartEndE-ValueType
low complexity region 6 13 N/A INTRINSIC
low complexity region 29 54 N/A INTRINSIC
Pfam:GMP_PDE_delta 80 212 1.3e-60 PFAM
Pfam:GMP_PDE_delta 218 258 1.5e-15 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is multifunctional, affecting trafficking of transducin in rod photoreceptors, interacting with src-type tyrosine kinases through SH2 and SH3 interacting domains, and aiding the uptake of bacteria through endocytosis. In addition, the encoded protein acts as a lipid-binding chaperone to help localize some myristoylated proteins correctly. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit retinal degeneration characterized by thinning of the outer nuclear layer of the retinal that is visible at 6 months and progresses rapidly after 17 to end-stage by 26 months. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A T 4: 53,067,151 V1352D probably damaging Het
Adam33 C T 2: 131,053,694 C567Y probably damaging Het
Alppl2 C A 1: 87,087,462 G422C probably benign Het
Ang T A 14: 51,101,411 I3K unknown Het
Ankrd10 A T 8: 11,615,841 V253E probably damaging Het
Arhgef17 T C 7: 100,877,797 I806V probably benign Het
Atp10b T C 11: 43,212,547 L586P probably damaging Het
Bdkrb1 T C 12: 105,604,304 V43A possibly damaging Het
Brinp3 C T 1: 146,682,688 R117* probably null Het
Brwd1 A T 16: 96,066,119 M172K probably damaging Het
Bsn G A 9: 108,126,421 R262* probably null Het
Bst2 A C 8: 71,537,207 L74R probably damaging Het
C1qa T C 4: 136,896,154 *246W probably null Het
Cadm2 G A 16: 66,882,846 T42M probably damaging Het
Ccdc150 A G 1: 54,259,966 T34A probably benign Het
Ccdc178 G A 18: 22,105,549 T337M probably benign Het
Ccl8 T C 11: 82,116,582 V81A probably damaging Het
Dgcr6 A G 16: 18,070,907 T69A unknown Het
Dnah10 A G 5: 124,821,269 D3762G probably benign Het
Eif3d T C 15: 77,961,676 T382A probably benign Het
Epb41 A T 4: 131,989,719 Y375N probably damaging Het
Epb41l1 A T 2: 156,503,851 H258L probably damaging Het
Fbn1 A C 2: 125,479,195 I81S possibly damaging Het
Fzd5 A G 1: 64,735,328 S425P probably damaging Het
Gfra2 T A 14: 70,968,391 V398D probably benign Het
Gm3755 A G 14: 7,448,178 L130P Het
Grin3b A G 10: 79,975,695 Y705C probably damaging Het
Hmcn2 A G 2: 31,459,081 D4944G probably damaging Het
Hoxd11 T C 2: 74,684,011 L295P probably damaging Het
Ighv1-81 C A 12: 115,920,667 G16C possibly damaging Het
Kcna5 T C 6: 126,533,791 D458G possibly damaging Het
Klb A T 5: 65,383,364 E933D probably benign Het
Lrp1 A T 10: 127,545,564 M3855K probably benign Het
Map3k4 A T 17: 12,270,946 L533I probably damaging Het
Mrps6 C A 16: 92,058,447 Y4* probably null Het
Nabp1 A T 1: 51,473,070 V105E probably damaging Het
Naip6 T A 13: 100,299,388 N876Y possibly damaging Het
Nlrp2 T C 7: 5,308,645 S944G possibly damaging Het
Nr4a3 A T 4: 48,083,238 E590D probably benign Het
Olfr1054 C T 2: 86,332,564 S264N probably benign Het
Olfr1106 A T 2: 87,048,479 Y252* probably null Het
Olfr1564 A G 17: 33,215,699 I215T probably damaging Het
Olfr362 T C 2: 37,105,591 R20G probably null Het
Olfr597 T A 7: 103,321,287 V292E Het
Pcp4l1 G A 1: 171,174,465 A42V possibly damaging Het
Pdzd2 T C 15: 12,437,162 D451G probably damaging Het
Pkd2l1 A G 19: 44,157,690 S142P probably benign Het
Postn T C 3: 54,370,280 L232P probably damaging Het
Prss8 T C 7: 127,929,563 T33A probably benign Het
Rapgef2 A T 3: 79,145,823 M1K probably null Het
Rasa3 T C 8: 13,595,857 N161S possibly damaging Het
Riox1 G A 12: 83,950,668 probably benign Het
Rmdn2 A T 17: 79,621,611 K97N probably damaging Het
Sgo1 A G 17: 53,677,057 L431P probably damaging Het
Slc9a8 T A 2: 167,451,302 V217E probably damaging Het
Slco2b1 C T 7: 99,691,848 G21D not run Het
Spata31d1d C A 13: 59,726,976 R915L probably benign Het
Stk17b A T 1: 53,765,945 N152K probably benign Het
Syne2 T A 12: 75,984,024 I3634N probably damaging Het
Tnfrsf9 A G 4: 150,934,337 D155G probably damaging Het
Tnrc6a T A 7: 123,171,508 D840E probably benign Het
Tyk2 G A 9: 21,110,204 S902L probably benign Het
Vav1 A C 17: 57,302,266 D394A probably benign Het
Vezf1 T A 11: 88,081,584 I439K possibly damaging Het
Zadh2 A G 18: 84,095,135 Y312C probably damaging Het
Zfp335 A T 2: 164,910,821 M1K probably null Het
Zfp715 T C 7: 43,311,138 T10A possibly damaging Het
Zmynd11 C T 13: 9,690,409 E382K possibly damaging Het
Other mutations in Unc119
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01155:Unc119 APN 11 78348609 missense probably damaging 1.00
IGL01317:Unc119 APN 11 78347226 missense probably damaging 0.99
IGL03164:Unc119 APN 11 78348176 missense probably damaging 1.00
R2166:Unc119 UTSW 11 78347335 splice site probably null
R4298:Unc119 UTSW 11 78348122 missense probably damaging 0.98
R5584:Unc119 UTSW 11 78348570 missense probably damaging 1.00
R6594:Unc119 UTSW 11 78347220 missense probably damaging 1.00
R7001:Unc119 UTSW 11 78348554 missense probably damaging 0.99
R7401:Unc119 UTSW 11 78347245 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTACCTATGCATCTGACCCC -3'
(R):5'- ACTAGCTCCAGAGGTTTGCC -3'

Sequencing Primer
(F):5'- CTCAGGAGCTCTCTGAAGTG -3'
(R):5'- CTAGGGATGCTGGACACCTTTC -3'
Posted On2019-06-26