Incidental Mutation 'R7323:Tnfrsf11a'
ID568257
Institutional Source Beutler Lab
Gene Symbol Tnfrsf11a
Ensembl Gene ENSMUSG00000026321
Gene Nametumor necrosis factor receptor superfamily, member 11a, NFKB activator
SynonymsTRANCE-R, Rank
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.176) question?
Stock #R7323 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location105780718-105847981 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 105844730 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 581 (D581G)
Ref Sequence ENSEMBL: ENSMUSP00000027559 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027559]
PDB Structure
Crystal structure of mouse RANKL-RANK complex [X-RAY DIFFRACTION]
Crystal structure of mouse RANK [X-RAY DIFFRACTION]
Crystal structure of extracellular domains of mouse RANK-RANKL complex [X-RAY DIFFRACTION]
Crystal Structure of mouse RANK bound to RANKL [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000027559
AA Change: D581G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000027559
Gene: ENSMUSG00000026321
AA Change: D581G

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
TNFR 35 69 1.48e-7 SMART
TNFR 72 113 2.59e-3 SMART
TNFR 115 152 4.28e-4 SMART
TNFR 155 195 5.27e-4 SMART
transmembrane domain 212 234 N/A INTRINSIC
low complexity region 300 313 N/A INTRINSIC
low complexity region 495 511 N/A INTRINSIC
low complexity region 543 558 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptors can interact with various TRAF family proteins, through which this receptor induces the activation of NF-kappa B and MAPK8/JNK. This receptor and its ligand are important regulators of the interaction between T cells and dendritic cells. This receptor is also an essential mediator for osteoclast and lymph node development. Mutations at this locus have been associated with familial expansile osteolysis, autosomal recessive osteopetrosis, and Paget disease of bone. Alternatively spliced transcript variants have been described for this locus. [provided by RefSeq, Aug 2012]
PHENOTYPE: Mice homozygous for a knock-out or spontaneous allele exhibit a failure of tooth eruption, osteopetrosis, and abnormal immune system morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930524J08Rik C A 5: 99,979,086 A9E unknown Het
Abcb11 C A 2: 69,287,635 Q466H probably damaging Het
Adam20 A G 8: 40,795,384 D177G probably benign Het
Ampd1 A T 3: 103,085,380 Q150L probably benign Het
Angpt2 A C 8: 18,705,824 M209R probably benign Het
Aoc2 G A 11: 101,328,545 R598Q probably damaging Het
Arap1 A G 7: 101,400,211 D960G probably damaging Het
Bhlhe40 G C 6: 108,665,281 L395F probably benign Het
Cacna1i T C 15: 80,391,653 C1882R possibly damaging Het
Ccr6 A G 17: 8,256,779 N272S possibly damaging Het
Ces1f A T 8: 93,271,844 W175R probably damaging Het
Ces3a A C 8: 105,055,607 H364P possibly damaging Het
Cfap54 T C 10: 92,801,138 M3130V probably benign Het
Clca3b G A 3: 144,825,920 P708S possibly damaging Het
Cps1 A T 1: 67,157,869 T360S probably benign Het
Cramp1l A T 17: 24,982,405 M701K possibly damaging Het
Dnah1 A G 14: 31,298,707 I1235T probably damaging Het
Ergic1 A G 17: 26,641,670 E244G probably damaging Het
Fignl2 C A 15: 101,053,501 R300L unknown Het
Fry T C 5: 150,496,349 M628T Het
Fscn3 A G 6: 28,431,545 T292A possibly damaging Het
Fsip2 A T 2: 82,989,516 I5198L probably benign Het
Gm11639 T C 11: 105,030,011 L4676P probably benign Het
Gm4181 T A 14: 51,632,533 R104W probably damaging Het
Gnl1 G A 17: 35,983,413 R308H probably benign Het
Gtf2h4 G T 17: 35,669,965 L271I probably damaging Het
Helq GTTT GTT 5: 100,783,185 probably null Het
Hhatl A T 9: 121,789,586 W117R probably benign Het
Hlx A G 1: 184,730,796 F220L probably benign Het
Il31ra T C 13: 112,551,963 I27V probably damaging Het
Itga8 T G 2: 12,262,129 D165A probably damaging Het
Krt33a A C 11: 100,011,975 V341G probably benign Het
Lrrc3c A G 11: 98,599,440 M208V possibly damaging Het
Mapk8ip3 A T 17: 24,901,161 S947T probably benign Het
Muc5b A G 7: 141,858,707 I1797V unknown Het
Myh2 A T 11: 67,197,365 T1936S probably benign Het
Nr1h2 T C 7: 44,550,322 Y391C possibly damaging Het
Olfr1168 A G 2: 88,185,608 T244A possibly damaging Het
Olfr1219 A T 2: 89,074,467 I208K probably damaging Het
Olfr1509 A G 14: 52,451,213 I267V probably benign Het
Olfr355 T A 2: 36,927,974 I47F probably damaging Het
Phf3 A G 1: 30,813,130 M1064T probably benign Het
Pkd1 A G 17: 24,575,051 E1904G probably benign Het
Polrmt A G 10: 79,740,649 V491A probably benign Het
Ppm1j C A 3: 104,784,113 R306S probably damaging Het
Prkd2 T C 7: 16,847,622 F134S probably benign Het
Prpf8 C A 11: 75,491,784 Q439K probably benign Het
Prss50 A T 9: 110,863,732 I307F possibly damaging Het
Rgs20 A G 1: 4,912,312 probably null Het
Rnf144b A G 13: 47,239,782 E199G probably damaging Het
Slc12a4 C T 8: 105,955,715 G121S probably damaging Het
Slc22a26 A T 19: 7,790,894 V233E probably damaging Het
Slc27a2 T G 2: 126,553,204 L17R probably benign Het
Slc6a17 A G 3: 107,491,478 V269A probably benign Het
Srp54c T C 12: 55,257,452 V395A probably benign Het
Sspo A T 6: 48,461,647 S1550C possibly damaging Het
Tet1 A G 10: 62,880,039 probably benign Het
Tmem63b G A 17: 45,660,847 T814M possibly damaging Het
Tnc G A 4: 63,971,232 T1679I probably damaging Het
Trim30d A C 7: 104,483,348 V244G probably benign Het
Trpv1 T C 11: 73,260,337 S784P possibly damaging Het
Tulp1 G A 17: 28,356,424 T103M probably damaging Het
Ubap2l A C 3: 90,015,406 V775G unknown Het
Vmn2r69 A C 7: 85,411,764 I204R possibly damaging Het
Vmn2r72 T A 7: 85,750,563 D426V probably benign Het
Vmn2r93 G A 17: 18,313,235 W467* probably null Het
Wbp2nl T C 15: 82,314,341 *360Q probably null Het
Xylt1 G A 7: 117,592,047 probably null Het
Zc3h6 T G 2: 128,993,411 N123K unknown Het
Zfp853 T C 5: 143,289,355 Q185R unknown Het
Other mutations in Tnfrsf11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01137:Tnfrsf11a APN 1 105809422 missense possibly damaging 0.80
IGL02429:Tnfrsf11a APN 1 105827718 missense probably benign 0.14
IGL03222:Tnfrsf11a APN 1 105821490 missense probably damaging 1.00
IGL03276:Tnfrsf11a APN 1 105821490 missense probably damaging 1.00
PIT4354001:Tnfrsf11a UTSW 1 105821517 missense probably damaging 1.00
R0321:Tnfrsf11a UTSW 1 105844857 nonsense probably null
R0514:Tnfrsf11a UTSW 1 105826992 missense probably damaging 1.00
R0655:Tnfrsf11a UTSW 1 105808155 missense unknown
R1470:Tnfrsf11a UTSW 1 105825048 missense probably damaging 0.96
R1470:Tnfrsf11a UTSW 1 105825048 missense probably damaging 0.96
R1868:Tnfrsf11a UTSW 1 105844705 missense probably damaging 1.00
R2900:Tnfrsf11a UTSW 1 105827061 missense probably benign 0.03
R3418:Tnfrsf11a UTSW 1 105809405 missense possibly damaging 0.84
R3816:Tnfrsf11a UTSW 1 105809360 missense probably damaging 0.96
R3817:Tnfrsf11a UTSW 1 105809360 missense probably damaging 0.96
R3818:Tnfrsf11a UTSW 1 105809360 missense probably damaging 0.96
R3819:Tnfrsf11a UTSW 1 105809360 missense probably damaging 0.96
R3879:Tnfrsf11a UTSW 1 105809360 missense probably damaging 0.96
R4037:Tnfrsf11a UTSW 1 105827739 splice site probably null
R4039:Tnfrsf11a UTSW 1 105827739 splice site probably null
R4238:Tnfrsf11a UTSW 1 105827237 missense probably damaging 1.00
R5708:Tnfrsf11a UTSW 1 105813820 intron probably null
R6102:Tnfrsf11a UTSW 1 105819946 missense possibly damaging 0.62
R6910:Tnfrsf11a UTSW 1 105844546 missense probably damaging 1.00
R7169:Tnfrsf11a UTSW 1 105844695 missense possibly damaging 0.95
R7178:Tnfrsf11a UTSW 1 105827539 missense probably benign 0.04
R7293:Tnfrsf11a UTSW 1 105808141 critical splice acceptor site probably null
R7334:Tnfrsf11a UTSW 1 105827129 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TAACTCCACGTTCATCTCTAGCGG -3'
(R):5'- ACAGTGGCTAGCTACACCATG -3'

Sequencing Primer
(F):5'- TTCATCTCTAGCGGGCAGG -3'
(R):5'- GCTACACCATGTTTTTGGAAAGGC -3'
Posted On2019-06-26