Incidental Mutation 'R7323:Slc27a2'
ID568265
Institutional Source Beutler Lab
Gene Symbol Slc27a2
Ensembl Gene ENSMUSG00000027359
Gene Namesolute carrier family 27 (fatty acid transporter), member 2
SynonymsVLCS, ACSVL1, Vlac, FATP2, FATP2, Vlacs
Accession Numbers

Genbank: NM_011978.2 ; Ensembl: ENSMUST00000061491, ENSMUST00000141482, ENSMUST00000126249, ENSMUST00000150947

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7323 (G1)
Quality Score197.009
Status Not validated
Chromosome2
Chromosomal Location126552407-126588243 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 126553204 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 17 (L17R)
Ref Sequence ENSEMBL: ENSMUSP00000057595 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061491] [ENSMUST00000141482]
Predicted Effect probably benign
Transcript: ENSMUST00000061491
AA Change: L17R

PolyPhen 2 Score 0.385 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000057595
Gene: ENSMUSG00000027359
AA Change: L17R

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
low complexity region 41 53 N/A INTRINSIC
Pfam:AMP-binding 59 488 1.4e-71 PFAM
Pfam:AMP-binding_C 496 572 1.9e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141482
SMART Domains Protein: ENSMUSP00000117145
Gene: ENSMUSG00000027359

DomainStartEndE-ValueType
Pfam:AMP-binding 7 256 6.2e-38 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an isozyme of long-chain fatty-acid-coenzyme A ligase family. Although differing in substrate specificity, subcellular localization, and tissue distribution, all isozymes of this family convert free long-chain fatty acids into fatty acyl-CoA esters, and thereby play a key role in lipid biosynthesis and fatty acid degradation. This isozyme activates long-chain, branched-chain and very-long-chain fatty acids containing 22 or more carbons to their CoA derivatives. It is expressed primarily in liver and kidney, and is present in both endoplasmic reticulum and peroxisomes, but not in mitochondria. Its decreased peroxisomal enzyme activity is in part responsible for the biochemical pathology in X-linked adrenoleukodystrophy. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2009]
PHENOTYPE: Homozygous mutant mice are viable and show no gross morphological abnormalities. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, knock-out(2) Targeted, other(2) Gene trapped(1)

Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930524J08Rik C A 5: 99,979,086 A9E unknown Het
Abcb11 C A 2: 69,287,635 Q466H probably damaging Het
Adam20 A G 8: 40,795,384 D177G probably benign Het
Ampd1 A T 3: 103,085,380 Q150L probably benign Het
Angpt2 A C 8: 18,705,824 M209R probably benign Het
Aoc2 G A 11: 101,328,545 R598Q probably damaging Het
Arap1 A G 7: 101,400,211 D960G probably damaging Het
Bhlhe40 G C 6: 108,665,281 L395F probably benign Het
Cacna1i T C 15: 80,391,653 C1882R possibly damaging Het
Ccr6 A G 17: 8,256,779 N272S possibly damaging Het
Ces1f A T 8: 93,271,844 W175R probably damaging Het
Ces3a A C 8: 105,055,607 H364P possibly damaging Het
Cfap54 T C 10: 92,801,138 M3130V probably benign Het
Clca3b G A 3: 144,825,920 P708S possibly damaging Het
Cps1 A T 1: 67,157,869 T360S probably benign Het
Cramp1l A T 17: 24,982,405 M701K possibly damaging Het
Dnah1 A G 14: 31,298,707 I1235T probably damaging Het
Ergic1 A G 17: 26,641,670 E244G probably damaging Het
Fignl2 C A 15: 101,053,501 R300L unknown Het
Fry T C 5: 150,496,349 M628T Het
Fscn3 A G 6: 28,431,545 T292A possibly damaging Het
Fsip2 A T 2: 82,989,516 I5198L probably benign Het
Gm11639 T C 11: 105,030,011 L4676P probably benign Het
Gm4181 T A 14: 51,632,533 R104W probably damaging Het
Gnl1 G A 17: 35,983,413 R308H probably benign Het
Gtf2h4 G T 17: 35,669,965 L271I probably damaging Het
Helq GTTT GTT 5: 100,783,185 probably null Het
Hhatl A T 9: 121,789,586 W117R probably benign Het
Hlx A G 1: 184,730,796 F220L probably benign Het
Il31ra T C 13: 112,551,963 I27V probably damaging Het
Itga8 T G 2: 12,262,129 D165A probably damaging Het
Krt33a A C 11: 100,011,975 V341G probably benign Het
Lrrc3c A G 11: 98,599,440 M208V possibly damaging Het
Mapk8ip3 A T 17: 24,901,161 S947T probably benign Het
Muc5b A G 7: 141,858,707 I1797V unknown Het
Myh2 A T 11: 67,197,365 T1936S probably benign Het
Nr1h2 T C 7: 44,550,322 Y391C possibly damaging Het
Olfr1168 A G 2: 88,185,608 T244A possibly damaging Het
Olfr1219 A T 2: 89,074,467 I208K probably damaging Het
Olfr1509 A G 14: 52,451,213 I267V probably benign Het
Olfr355 T A 2: 36,927,974 I47F probably damaging Het
Phf3 A G 1: 30,813,130 M1064T probably benign Het
Pkd1 A G 17: 24,575,051 E1904G probably benign Het
Polrmt A G 10: 79,740,649 V491A probably benign Het
Ppm1j C A 3: 104,784,113 R306S probably damaging Het
Prkd2 T C 7: 16,847,622 F134S probably benign Het
Prpf8 C A 11: 75,491,784 Q439K probably benign Het
Prss50 A T 9: 110,863,732 I307F possibly damaging Het
Rgs20 A G 1: 4,912,312 probably null Het
Rnf144b A G 13: 47,239,782 E199G probably damaging Het
Slc12a4 C T 8: 105,955,715 G121S probably damaging Het
Slc22a26 A T 19: 7,790,894 V233E probably damaging Het
Slc6a17 A G 3: 107,491,478 V269A probably benign Het
Srp54c T C 12: 55,257,452 V395A probably benign Het
Sspo A T 6: 48,461,647 S1550C possibly damaging Het
Tet1 A G 10: 62,880,039 probably benign Het
Tmem63b G A 17: 45,660,847 T814M possibly damaging Het
Tnc G A 4: 63,971,232 T1679I probably damaging Het
Tnfrsf11a A G 1: 105,844,730 D581G probably damaging Het
Trim30d A C 7: 104,483,348 V244G probably benign Het
Trpv1 T C 11: 73,260,337 S784P possibly damaging Het
Tulp1 G A 17: 28,356,424 T103M probably damaging Het
Ubap2l A C 3: 90,015,406 V775G unknown Het
Vmn2r69 A C 7: 85,411,764 I204R possibly damaging Het
Vmn2r72 T A 7: 85,750,563 D426V probably benign Het
Vmn2r93 G A 17: 18,313,235 W467* probably null Het
Wbp2nl T C 15: 82,314,341 *360Q probably null Het
Xylt1 G A 7: 117,592,047 probably null Het
Zc3h6 T G 2: 128,993,411 N123K unknown Het
Zfp853 T C 5: 143,289,355 Q185R unknown Het
Other mutations in Slc27a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Slc27a2 APN 2 126580917 missense probably damaging 1.00
IGL01907:Slc27a2 APN 2 126587874 missense probably benign 0.02
IGL02185:Slc27a2 APN 2 126567816 missense probably damaging 0.99
IGL02363:Slc27a2 APN 2 126578950 missense possibly damaging 0.58
IGL02451:Slc27a2 APN 2 126578992 missense probably benign 0.00
IGL02486:Slc27a2 APN 2 126553350 missense probably benign 0.00
IGL03217:Slc27a2 APN 2 126586252 missense possibly damaging 0.80
IGL03287:Slc27a2 APN 2 126553392 missense probably damaging 1.00
IGL03291:Slc27a2 APN 2 126564750 missense probably benign 0.14
baseboard UTSW 2 126567780 missense probably damaging 0.97
B6584:Slc27a2 UTSW 2 126561642 missense possibly damaging 0.94
R0021:Slc27a2 UTSW 2 126567886 splice site probably benign
R0647:Slc27a2 UTSW 2 126587916 missense probably benign 0.00
R1326:Slc27a2 UTSW 2 126564770 missense probably damaging 1.00
R1509:Slc27a2 UTSW 2 126553314 missense possibly damaging 0.95
R1907:Slc27a2 UTSW 2 126586342 missense probably benign 0.13
R2012:Slc27a2 UTSW 2 126553615 missense probably damaging 0.98
R2217:Slc27a2 UTSW 2 126567752 missense probably damaging 0.99
R3769:Slc27a2 UTSW 2 126567798 missense possibly damaging 0.90
R3770:Slc27a2 UTSW 2 126567798 missense possibly damaging 0.90
R5244:Slc27a2 UTSW 2 126578855 missense probably benign 0.00
R5459:Slc27a2 UTSW 2 126580992 missense probably damaging 0.98
R5582:Slc27a2 UTSW 2 126564690 missense probably damaging 1.00
R5606:Slc27a2 UTSW 2 126564690 missense probably damaging 1.00
R5655:Slc27a2 UTSW 2 126578939 missense probably damaging 1.00
R5680:Slc27a2 UTSW 2 126561610 missense probably benign 0.02
R5747:Slc27a2 UTSW 2 126564738 missense probably benign
R6346:Slc27a2 UTSW 2 126587880 missense probably damaging 0.97
R7042:Slc27a2 UTSW 2 126567780 missense probably damaging 0.97
R7297:Slc27a2 UTSW 2 126578946 missense probably damaging 0.99
R7391:Slc27a2 UTSW 2 126553162 missense unknown
Predicted Primers PCR Primer
(F):5'- GACACTGAACACAAGTGCTG -3'
(R):5'- CATGAAGAGGGCTACGCAATC -3'

Sequencing Primer
(F):5'- ACCCAGGCTGACAGGAG -3'
(R):5'- CTGTCGTAGGCCCAGTTGATC -3'
Posted On2019-06-26