Incidental Mutation 'R7323:Nr1h2'
ID568281
Institutional Source Beutler Lab
Gene Symbol Nr1h2
Ensembl Gene ENSMUSG00000060601
Gene Namenuclear receptor subfamily 1, group H, member 2
SynonymsRIP15, LXRB, Unr2, LXRbeta
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.614) question?
Stock #R7323 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location44549616-44553951 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 44550322 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 391 (Y391C)
Ref Sequence ENSEMBL: ENSMUSP00000073188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049343] [ENSMUST00000073488] [ENSMUST00000107910] [ENSMUST00000107911] [ENSMUST00000107912] [ENSMUST00000128600] [ENSMUST00000142298] [ENSMUST00000145956] [ENSMUST00000151793] [ENSMUST00000167197] [ENSMUST00000207737] [ENSMUST00000208366] [ENSMUST00000209017]
Predicted Effect probably benign
Transcript: ENSMUST00000049343
SMART Domains Protein: ENSMUSP00000039776
Gene: ENSMUSG00000038644

DomainStartEndE-ValueType
coiled coil region 34 58 N/A INTRINSIC
Blast:POLBc 65 108 1e-7 BLAST
low complexity region 212 225 N/A INTRINSIC
Blast:POLBc 227 279 1e-19 BLAST
POLBc 306 763 2.53e-161 SMART
Blast:POLBc 790 837 1e-18 BLAST
Pfam:zf-C4pol 1010 1080 5.1e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000073488
AA Change: Y391C

PolyPhen 2 Score 0.653 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000073188
Gene: ENSMUSG00000060601
AA Change: Y391C

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
low complexity region 55 66 N/A INTRINSIC
ZnF_C4 75 148 5.81e-32 SMART
low complexity region 153 188 N/A INTRINSIC
low complexity region 190 202 N/A INTRINSIC
HOLI 258 417 2.08e-42 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000107910
AA Change: Y388C

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103543
Gene: ENSMUSG00000060601
AA Change: Y388C

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
low complexity region 52 63 N/A INTRINSIC
ZnF_C4 72 145 5.81e-32 SMART
low complexity region 150 185 N/A INTRINSIC
low complexity region 187 199 N/A INTRINSIC
HOLI 255 414 2.08e-42 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000107911
AA Change: Y388C

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103544
Gene: ENSMUSG00000060601
AA Change: Y388C

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
low complexity region 52 63 N/A INTRINSIC
ZnF_C4 72 145 5.81e-32 SMART
low complexity region 150 185 N/A INTRINSIC
low complexity region 187 199 N/A INTRINSIC
HOLI 255 414 2.08e-42 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000107912
AA Change: Y391C

PolyPhen 2 Score 0.653 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000103545
Gene: ENSMUSG00000060601
AA Change: Y391C

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
low complexity region 55 66 N/A INTRINSIC
ZnF_C4 75 148 5.81e-32 SMART
low complexity region 153 188 N/A INTRINSIC
low complexity region 190 202 N/A INTRINSIC
HOLI 258 417 2.08e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128600
Predicted Effect probably benign
Transcript: ENSMUST00000142298
Predicted Effect probably benign
Transcript: ENSMUST00000145956
SMART Domains Protein: ENSMUSP00000117844
Gene: ENSMUSG00000038644

DomainStartEndE-ValueType
coiled coil region 34 58 N/A INTRINSIC
Blast:POLBc 65 108 2e-8 BLAST
PDB:3IAY|A 76 151 7e-8 PDB
SCOP:d1tgoa1 117 153 3e-10 SMART
Blast:POLBc 130 153 7e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000151793
SMART Domains Protein: ENSMUSP00000117157
Gene: ENSMUSG00000038644

DomainStartEndE-ValueType
coiled coil region 34 58 N/A INTRINSIC
Blast:POLBc 66 108 1e-7 BLAST
low complexity region 212 225 N/A INTRINSIC
Blast:POLBc 227 279 1e-19 BLAST
POLBc 306 763 7.8e-164 SMART
Blast:POLBc 790 837 1e-18 BLAST
low complexity region 914 938 N/A INTRINSIC
low complexity region 959 980 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000167197
AA Change: Y391C

PolyPhen 2 Score 0.653 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000126788
Gene: ENSMUSG00000060601
AA Change: Y391C

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
low complexity region 55 66 N/A INTRINSIC
ZnF_C4 75 148 5.81e-32 SMART
low complexity region 153 188 N/A INTRINSIC
low complexity region 190 202 N/A INTRINSIC
HOLI 258 417 2.08e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207737
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000208366
Predicted Effect probably benign
Transcript: ENSMUST00000209017
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The liver X receptors, LXRA (NR1H3; MIM 602423) and LXRB, form a subfamily of the nuclear receptor superfamily and are key regulators of macrophage function, controlling transcriptional programs involved in lipid homeostasis and inflammation. The inducible LXRA is highly expressed in liver, adrenal gland, intestine, adipose tissue, macrophages, lung, and kidney, whereas LXRB is ubiquitously expressed. Ligand-activated LXRs form obligate heterodimers with retinoid X receptors (RXRs; see MIM 180245) and regulate expression of target genes containing LXR response elements (summary by Korf et al., 2009 [PubMed 19436111]).[supplied by OMIM, Jan 2010]
PHENOTYPE: Homozygous null mutations cause altered lipid, cholesterol and glucose metabolism and may lead to elevated cartilage matrix catabolism and PGE2 production, lipid-laden uterus myocytes and Sertoli cells, impaired uterus contractility and parturition, and higher susceptibility to bacterial infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930524J08Rik C A 5: 99,979,086 A9E unknown Het
Abcb11 C A 2: 69,287,635 Q466H probably damaging Het
Adam20 A G 8: 40,795,384 D177G probably benign Het
Ampd1 A T 3: 103,085,380 Q150L probably benign Het
Angpt2 A C 8: 18,705,824 M209R probably benign Het
Aoc2 G A 11: 101,328,545 R598Q probably damaging Het
Arap1 A G 7: 101,400,211 D960G probably damaging Het
Bhlhe40 G C 6: 108,665,281 L395F probably benign Het
Cacna1i T C 15: 80,391,653 C1882R possibly damaging Het
Ccr6 A G 17: 8,256,779 N272S possibly damaging Het
Ces1f A T 8: 93,271,844 W175R probably damaging Het
Ces3a A C 8: 105,055,607 H364P possibly damaging Het
Cfap54 T C 10: 92,801,138 M3130V probably benign Het
Clca3b G A 3: 144,825,920 P708S possibly damaging Het
Cps1 A T 1: 67,157,869 T360S probably benign Het
Cramp1l A T 17: 24,982,405 M701K possibly damaging Het
Dnah1 A G 14: 31,298,707 I1235T probably damaging Het
Ergic1 A G 17: 26,641,670 E244G probably damaging Het
Fignl2 C A 15: 101,053,501 R300L unknown Het
Fry T C 5: 150,496,349 M628T Het
Fscn3 A G 6: 28,431,545 T292A possibly damaging Het
Fsip2 A T 2: 82,989,516 I5198L probably benign Het
Gm11639 T C 11: 105,030,011 L4676P probably benign Het
Gm4181 T A 14: 51,632,533 R104W probably damaging Het
Gnl1 G A 17: 35,983,413 R308H probably benign Het
Gtf2h4 G T 17: 35,669,965 L271I probably damaging Het
Helq GTTT GTT 5: 100,783,185 probably null Het
Hhatl A T 9: 121,789,586 W117R probably benign Het
Hlx A G 1: 184,730,796 F220L probably benign Het
Il31ra T C 13: 112,551,963 I27V probably damaging Het
Itga8 T G 2: 12,262,129 D165A probably damaging Het
Krt33a A C 11: 100,011,975 V341G probably benign Het
Lrrc3c A G 11: 98,599,440 M208V possibly damaging Het
Mapk8ip3 A T 17: 24,901,161 S947T probably benign Het
Muc5b A G 7: 141,858,707 I1797V unknown Het
Myh2 A T 11: 67,197,365 T1936S probably benign Het
Olfr1168 A G 2: 88,185,608 T244A possibly damaging Het
Olfr1219 A T 2: 89,074,467 I208K probably damaging Het
Olfr1509 A G 14: 52,451,213 I267V probably benign Het
Olfr355 T A 2: 36,927,974 I47F probably damaging Het
Phf3 A G 1: 30,813,130 M1064T probably benign Het
Pkd1 A G 17: 24,575,051 E1904G probably benign Het
Polrmt A G 10: 79,740,649 V491A probably benign Het
Ppm1j C A 3: 104,784,113 R306S probably damaging Het
Prkd2 T C 7: 16,847,622 F134S probably benign Het
Prpf8 C A 11: 75,491,784 Q439K probably benign Het
Prss50 A T 9: 110,863,732 I307F possibly damaging Het
Rgs20 A G 1: 4,912,312 probably null Het
Rnf144b A G 13: 47,239,782 E199G probably damaging Het
Slc12a4 C T 8: 105,955,715 G121S probably damaging Het
Slc22a26 A T 19: 7,790,894 V233E probably damaging Het
Slc27a2 T G 2: 126,553,204 L17R probably benign Het
Slc6a17 A G 3: 107,491,478 V269A probably benign Het
Srp54c T C 12: 55,257,452 V395A probably benign Het
Sspo A T 6: 48,461,647 S1550C possibly damaging Het
Tet1 A G 10: 62,880,039 probably benign Het
Tmem63b G A 17: 45,660,847 T814M possibly damaging Het
Tnc G A 4: 63,971,232 T1679I probably damaging Het
Tnfrsf11a A G 1: 105,844,730 D581G probably damaging Het
Trim30d A C 7: 104,483,348 V244G probably benign Het
Trpv1 T C 11: 73,260,337 S784P possibly damaging Het
Tulp1 G A 17: 28,356,424 T103M probably damaging Het
Ubap2l A C 3: 90,015,406 V775G unknown Het
Vmn2r69 A C 7: 85,411,764 I204R possibly damaging Het
Vmn2r72 T A 7: 85,750,563 D426V probably benign Het
Vmn2r93 G A 17: 18,313,235 W467* probably null Het
Wbp2nl T C 15: 82,314,341 *360Q probably null Het
Xylt1 G A 7: 117,592,047 probably null Het
Zc3h6 T G 2: 128,993,411 N123K unknown Het
Zfp853 T C 5: 143,289,355 Q185R unknown Het
Other mutations in Nr1h2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02211:Nr1h2 APN 7 44550460 missense probably damaging 1.00
IGL02327:Nr1h2 APN 7 44551500 unclassified probably benign
bisogno UTSW 7 44550013 missense probably damaging 1.00
quiero UTSW 7 44552537 missense probably benign 0.27
R0179:Nr1h2 UTSW 7 44552265 intron probably null
R0433:Nr1h2 UTSW 7 44549987 makesense probably null
R0597:Nr1h2 UTSW 7 44552260 intron probably benign
R2432:Nr1h2 UTSW 7 44551367 missense possibly damaging 0.46
R4635:Nr1h2 UTSW 7 44552537 missense probably benign 0.27
R4662:Nr1h2 UTSW 7 44550431 missense probably damaging 1.00
R4675:Nr1h2 UTSW 7 44552555 missense possibly damaging 0.66
R4782:Nr1h2 UTSW 7 44550499 missense possibly damaging 0.93
R5064:Nr1h2 UTSW 7 44551649 missense possibly damaging 0.82
R5191:Nr1h2 UTSW 7 44550416 missense probably damaging 1.00
R6266:Nr1h2 UTSW 7 44552052 nonsense probably null
R6933:Nr1h2 UTSW 7 44550013 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATGAGCATGCGTGGGAAG -3'
(R):5'- GCAGGTGGAATTCATCAATCC -3'

Sequencing Primer
(F):5'- TGGTCCTGCAGGGAGAG -3'
(R):5'- GGAATTCATCAATCCCATCTTCGAG -3'
Posted On2019-06-26