Incidental Mutation 'R7323:Vmn2r69'
ID568282
Institutional Source Beutler Lab
Gene Symbol Vmn2r69
Ensembl Gene ENSMUSG00000091006
Gene Namevomeronasal 2, receptor 69
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R7323 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location85404849-85417476 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 85411764 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Arginine at position 204 (I204R)
Ref Sequence ENSEMBL: ENSMUSP00000132726 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171213]
Predicted Effect possibly damaging
Transcript: ENSMUST00000171213
AA Change: I204R

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000132726
Gene: ENSMUSG00000091006
AA Change: I204R

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 77 465 1.3e-28 PFAM
Pfam:NCD3G 507 559 1.8e-20 PFAM
Pfam:7tm_3 592 827 3.2e-54 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930524J08Rik C A 5: 99,979,086 A9E unknown Het
Abcb11 C A 2: 69,287,635 Q466H probably damaging Het
Adam20 A G 8: 40,795,384 D177G probably benign Het
Ampd1 A T 3: 103,085,380 Q150L probably benign Het
Angpt2 A C 8: 18,705,824 M209R probably benign Het
Aoc2 G A 11: 101,328,545 R598Q probably damaging Het
Arap1 A G 7: 101,400,211 D960G probably damaging Het
Bhlhe40 G C 6: 108,665,281 L395F probably benign Het
Cacna1i T C 15: 80,391,653 C1882R possibly damaging Het
Ccr6 A G 17: 8,256,779 N272S possibly damaging Het
Ces1f A T 8: 93,271,844 W175R probably damaging Het
Ces3a A C 8: 105,055,607 H364P possibly damaging Het
Cfap54 T C 10: 92,801,138 M3130V probably benign Het
Clca3b G A 3: 144,825,920 P708S possibly damaging Het
Cps1 A T 1: 67,157,869 T360S probably benign Het
Cramp1l A T 17: 24,982,405 M701K possibly damaging Het
Dnah1 A G 14: 31,298,707 I1235T probably damaging Het
Ergic1 A G 17: 26,641,670 E244G probably damaging Het
Fignl2 C A 15: 101,053,501 R300L unknown Het
Fry T C 5: 150,496,349 M628T Het
Fscn3 A G 6: 28,431,545 T292A possibly damaging Het
Fsip2 A T 2: 82,989,516 I5198L probably benign Het
Gm11639 T C 11: 105,030,011 L4676P probably benign Het
Gm4181 T A 14: 51,632,533 R104W probably damaging Het
Gnl1 G A 17: 35,983,413 R308H probably benign Het
Gtf2h4 G T 17: 35,669,965 L271I probably damaging Het
Helq GTTT GTT 5: 100,783,185 probably null Het
Hhatl A T 9: 121,789,586 W117R probably benign Het
Hlx A G 1: 184,730,796 F220L probably benign Het
Il31ra T C 13: 112,551,963 I27V probably damaging Het
Itga8 T G 2: 12,262,129 D165A probably damaging Het
Krt33a A C 11: 100,011,975 V341G probably benign Het
Lrrc3c A G 11: 98,599,440 M208V possibly damaging Het
Mapk8ip3 A T 17: 24,901,161 S947T probably benign Het
Muc5b A G 7: 141,858,707 I1797V unknown Het
Myh2 A T 11: 67,197,365 T1936S probably benign Het
Nr1h2 T C 7: 44,550,322 Y391C possibly damaging Het
Olfr1168 A G 2: 88,185,608 T244A possibly damaging Het
Olfr1219 A T 2: 89,074,467 I208K probably damaging Het
Olfr1509 A G 14: 52,451,213 I267V probably benign Het
Olfr355 T A 2: 36,927,974 I47F probably damaging Het
Phf3 A G 1: 30,813,130 M1064T probably benign Het
Pkd1 A G 17: 24,575,051 E1904G probably benign Het
Polrmt A G 10: 79,740,649 V491A probably benign Het
Ppm1j C A 3: 104,784,113 R306S probably damaging Het
Prkd2 T C 7: 16,847,622 F134S probably benign Het
Prpf8 C A 11: 75,491,784 Q439K probably benign Het
Prss50 A T 9: 110,863,732 I307F possibly damaging Het
Rgs20 A G 1: 4,912,312 probably null Het
Rnf144b A G 13: 47,239,782 E199G probably damaging Het
Slc12a4 C T 8: 105,955,715 G121S probably damaging Het
Slc22a26 A T 19: 7,790,894 V233E probably damaging Het
Slc27a2 T G 2: 126,553,204 L17R probably benign Het
Slc6a17 A G 3: 107,491,478 V269A probably benign Het
Srp54c T C 12: 55,257,452 V395A probably benign Het
Sspo A T 6: 48,461,647 S1550C possibly damaging Het
Tet1 A G 10: 62,880,039 probably benign Het
Tmem63b G A 17: 45,660,847 T814M possibly damaging Het
Tnc G A 4: 63,971,232 T1679I probably damaging Het
Tnfrsf11a A G 1: 105,844,730 D581G probably damaging Het
Trim30d A C 7: 104,483,348 V244G probably benign Het
Trpv1 T C 11: 73,260,337 S784P possibly damaging Het
Tulp1 G A 17: 28,356,424 T103M probably damaging Het
Ubap2l A C 3: 90,015,406 V775G unknown Het
Vmn2r72 T A 7: 85,750,563 D426V probably benign Het
Vmn2r93 G A 17: 18,313,235 W467* probably null Het
Wbp2nl T C 15: 82,314,341 *360Q probably null Het
Xylt1 G A 7: 117,592,047 probably null Het
Zc3h6 T G 2: 128,993,411 N123K unknown Het
Zfp853 T C 5: 143,289,355 Q185R unknown Het
Other mutations in Vmn2r69
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01019:Vmn2r69 APN 7 85406531 missense probably benign
IGL01457:Vmn2r69 APN 7 85406628 missense possibly damaging 0.87
IGL01760:Vmn2r69 APN 7 85406864 missense possibly damaging 0.90
IGL01834:Vmn2r69 APN 7 85412368 missense probably damaging 1.00
IGL02001:Vmn2r69 APN 7 85407226 missense probably benign 0.05
IGL02057:Vmn2r69 APN 7 85411782 missense possibly damaging 0.93
IGL02289:Vmn2r69 APN 7 85406846 missense probably damaging 1.00
IGL02472:Vmn2r69 APN 7 85409752 missense probably benign 0.01
IGL02478:Vmn2r69 APN 7 85406681 missense probably damaging 1.00
IGL02554:Vmn2r69 APN 7 85409806 missense probably damaging 1.00
IGL02723:Vmn2r69 APN 7 85410208 missense probably damaging 1.00
R0526:Vmn2r69 UTSW 7 85411503 missense probably damaging 1.00
R0560:Vmn2r69 UTSW 7 85409714 critical splice donor site probably null
R0909:Vmn2r69 UTSW 7 85406665 missense probably benign 0.00
R0976:Vmn2r69 UTSW 7 85406900 missense probably damaging 1.00
R1158:Vmn2r69 UTSW 7 85409850 splice site probably benign
R1459:Vmn2r69 UTSW 7 85406700 nonsense probably null
R1482:Vmn2r69 UTSW 7 85406874 missense probably damaging 1.00
R1917:Vmn2r69 UTSW 7 85411683 missense probably damaging 1.00
R2016:Vmn2r69 UTSW 7 85407285 missense probably damaging 0.98
R2108:Vmn2r69 UTSW 7 85410196 missense probably benign
R2571:Vmn2r69 UTSW 7 85415556 missense probably benign
R2910:Vmn2r69 UTSW 7 85406710 missense probably damaging 1.00
R2920:Vmn2r69 UTSW 7 85411765 missense probably benign 0.08
R3708:Vmn2r69 UTSW 7 85411821 missense probably damaging 0.98
R3710:Vmn2r69 UTSW 7 85406393 missense probably benign
R4757:Vmn2r69 UTSW 7 85412367 missense probably damaging 0.99
R4823:Vmn2r69 UTSW 7 85411300 missense probably benign 0.21
R4870:Vmn2r69 UTSW 7 85411585 missense possibly damaging 0.93
R4918:Vmn2r69 UTSW 7 85406759 missense probably benign 0.06
R5022:Vmn2r69 UTSW 7 85411159 missense possibly damaging 0.72
R5174:Vmn2r69 UTSW 7 85415531 missense possibly damaging 0.92
R5200:Vmn2r69 UTSW 7 85406509 missense probably damaging 1.00
R5278:Vmn2r69 UTSW 7 85411783 missense probably benign 0.02
R5643:Vmn2r69 UTSW 7 85407196 missense probably damaging 0.98
R5996:Vmn2r69 UTSW 7 85411909 splice site probably null
R6083:Vmn2r69 UTSW 7 85406503 missense probably damaging 1.00
R6140:Vmn2r69 UTSW 7 85411449 missense probably damaging 0.99
R6306:Vmn2r69 UTSW 7 85415591 missense probably benign 0.04
R6330:Vmn2r69 UTSW 7 85411627 missense probably benign
R6380:Vmn2r69 UTSW 7 85411859 missense probably benign
R6466:Vmn2r69 UTSW 7 85407170 missense probably benign 0.01
R6542:Vmn2r69 UTSW 7 85411205 nonsense probably null
R6583:Vmn2r69 UTSW 7 85409809 missense probably benign
R6623:Vmn2r69 UTSW 7 85407101 missense possibly damaging 0.84
R6709:Vmn2r69 UTSW 7 85411861 missense probably benign 0.03
R6732:Vmn2r69 UTSW 7 85411143 missense probably benign 0.00
R6741:Vmn2r69 UTSW 7 85412516 missense probably benign 0.01
R7070:Vmn2r69 UTSW 7 85411480 missense probably damaging 0.98
R7234:Vmn2r69 UTSW 7 85407107 missense probably benign 0.22
R7427:Vmn2r69 UTSW 7 85411259 missense probably benign 0.28
R7428:Vmn2r69 UTSW 7 85411259 missense probably benign 0.28
R7453:Vmn2r69 UTSW 7 85411560 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TGAGATATCCACAATGTGAGGGC -3'
(R):5'- GCAGTCCATCATGTTCATATTATTGCC -3'

Sequencing Primer
(F):5'- CCACAATGTGAGGGCATAATTTATGG -3'
(R):5'- ATTGCCTATGTACTGTATTTTTCAGC -3'
Posted On2019-06-26