Incidental Mutation 'R6973:Dgka'
ID568325
Institutional Source Beutler Lab
Gene Symbol Dgka
Ensembl Gene ENSMUSG00000025357
Gene Namediacylglycerol kinase, alpha
SynonymsDagk1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.471) question?
Stock #R6973 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location128720134-128744855 bp(-) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) C to T at 128729594 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000026414 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026414] [ENSMUST00000219834]
Predicted Effect probably null
Transcript: ENSMUST00000026414
SMART Domains Protein: ENSMUSP00000026414
Gene: ENSMUSG00000025357

DomainStartEndE-ValueType
Pfam:DAG_kinase_N 4 93 6.9e-31 PFAM
EFh 115 143 3.82e0 SMART
EFh 160 188 1.29e-4 SMART
C1 207 254 2.29e-10 SMART
C1 269 320 6.91e-5 SMART
DAGKc 372 495 3.11e-62 SMART
DAGKa 515 696 4.1e-103 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000219834
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 95% (37/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the eukaryotic diacylglycerol kinase family. It acts as a modulator that competes with protein kinase C for the second messenger diacylglycerol in intracellular signaling pathways. It also plays an important role in the resynthesis of phosphatidylinositols and phosphorylating diacylglycerol to phosphatidic acid. Alternative splicing occurs at this locus and four transcript variants encoding the same protein have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in impaired induction of T cell anergy. T cells stimulated in anergy producing conditions show increased proliferation and interleukin 2 production. Mice homozygous for a transgenic gene disruption exhibit male infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A G 13: 59,742,707 I433T probably benign Het
Aadacl3 T C 4: 144,456,190 Y236C probably benign Het
Adamts12 T A 15: 11,331,780 C1461* probably null Het
Akap9 A G 5: 4,046,699 N2525D possibly damaging Het
Atp6v1c1 A G 15: 38,690,550 N315S probably damaging Het
B3gnt7 G A 1: 86,305,387 M1I probably null Het
C2cd4d G T 3: 94,363,823 R132L probably damaging Het
Cd244 A G 1: 171,574,207 Y167C probably damaging Het
Chd4 A G 6: 125,122,862 N1666D possibly damaging Het
Cubn A G 2: 13,381,837 I1539T possibly damaging Het
Dcdc2a A T 13: 25,120,389 probably benign Het
Ephb4 T G 5: 137,369,804 V737G probably damaging Het
Etv2 T C 7: 30,634,742 N189D probably benign Het
Exoc4 G T 6: 33,580,030 C490F probably damaging Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Gpbp1l1 A G 4: 116,581,282 M192V possibly damaging Het
Ireb2 A G 9: 54,882,387 K115R probably benign Het
Mybpc1 T C 10: 88,560,361 E208G possibly damaging Het
Nfic C A 10: 81,420,357 A158S probably benign Het
Nos3 A T 5: 24,380,243 I798L probably benign Het
Ntrk1 A T 3: 87,783,981 L292Q probably damaging Het
Olfr1038-ps C T 2: 86,122,854 T310I probably benign Het
Olfr652 G A 7: 104,564,976 V252I probably benign Het
Pcdhb2 G C 18: 37,296,363 R463P probably benign Het
Pcdhgb6 A T 18: 37,742,473 D78V possibly damaging Het
Peg10 CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC CATC 6: 4,756,431 probably benign Het
Prelid3b C A 2: 174,469,362 W59L probably benign Het
Prex2 T G 1: 11,112,743 S405R probably damaging Het
Rp1 G A 1: 4,351,994 Q248* probably null Het
Rspo4 T A 2: 151,867,815 C47S probably damaging Het
Ryr3 C A 2: 112,766,311 M2499I probably damaging Het
Smarca5 A G 8: 80,704,751 Y946H probably damaging Het
Tcn2 T C 11: 3,917,649 *431W probably null Het
Tert A G 13: 73,627,988 E286G probably benign Het
Tnni3 A G 7: 4,518,417 I196T possibly damaging Het
Unc79 T C 12: 102,998,440 I49T possibly damaging Het
Zfp687 A G 3: 95,009,377 S813P possibly damaging Het
Znfx1 T A 2: 167,056,761 H81L probably benign Het
Other mutations in Dgka
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Dgka APN 10 128733086 missense probably damaging 1.00
IGL02479:Dgka APN 10 128730246 missense probably benign 0.01
IGL02727:Dgka APN 10 128722448 splice site probably benign
IGL02817:Dgka APN 10 128730228 missense probably benign
IGL02882:Dgka APN 10 128733384 missense possibly damaging 0.77
IGL03239:Dgka APN 10 128721385 splice site probably benign
R0321:Dgka UTSW 10 128721083 splice site probably benign
R0374:Dgka UTSW 10 128721083 splice site probably benign
R0482:Dgka UTSW 10 128734121 nonsense probably null
R0494:Dgka UTSW 10 128721083 splice site probably benign
R0573:Dgka UTSW 10 128737007 critical splice donor site probably null
R0594:Dgka UTSW 10 128733110 splice site probably benign
R0607:Dgka UTSW 10 128720469 unclassified probably null
R0618:Dgka UTSW 10 128721083 splice site probably benign
R0691:Dgka UTSW 10 128723260 splice site probably benign
R1378:Dgka UTSW 10 128735827 splice site probably null
R1424:Dgka UTSW 10 128733333 missense possibly damaging 0.57
R1955:Dgka UTSW 10 128730189 critical splice donor site probably null
R1972:Dgka UTSW 10 128720466 missense probably damaging 0.99
R1998:Dgka UTSW 10 128729939 missense probably benign 0.00
R2046:Dgka UTSW 10 128723535 missense probably damaging 1.00
R4206:Dgka UTSW 10 128721195 missense probably damaging 1.00
R4418:Dgka UTSW 10 128728094 missense probably damaging 1.00
R4752:Dgka UTSW 10 128736659 missense probably benign 0.03
R5092:Dgka UTSW 10 128735833 missense probably damaging 0.99
R5479:Dgka UTSW 10 128729672 critical splice acceptor site probably null
R6009:Dgka UTSW 10 128723679 missense probably damaging 1.00
R6273:Dgka UTSW 10 128723646 missense probably benign 0.03
R6852:Dgka UTSW 10 128722539 missense probably damaging 1.00
R6947:Dgka UTSW 10 128733015 missense probably damaging 1.00
R7024:Dgka UTSW 10 128720487 missense probably damaging 1.00
R7076:Dgka UTSW 10 128733583 missense probably damaging 0.99
R7290:Dgka UTSW 10 128733599 missense probably damaging 0.99
X0020:Dgka UTSW 10 128721317 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCTGAGCTCTTGGGTCTCC -3'
(R):5'- GGCCTATGCTGGTTCTTCCTAG -3'

Sequencing Primer
(F):5'- TGGGTCTCCTATCCTAACAGACAG -3'
(R):5'- TCCTAGATGGAGAGAGAGGATC -3'
Posted On2019-07-01