Incidental Mutation 'R7022:Cnnm2'
ID568346
Institutional Source Beutler Lab
Gene Symbol Cnnm2
Ensembl Gene ENSMUSG00000064105
Gene Namecyclin M2
SynonymsAcdp2
MMRRC Submission
Accession Numbers

Genbank: NM_033569; MGI: 2151054

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7022 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location46761596-46878795 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 46858940 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000096972 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077666] [ENSMUST00000099373]
Predicted Effect probably null
Transcript: ENSMUST00000077666
SMART Domains Protein: ENSMUSP00000076850
Gene: ENSMUSG00000064105

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 41 54 N/A INTRINSIC
low complexity region 56 67 N/A INTRINSIC
low complexity region 194 227 N/A INTRINSIC
Pfam:DUF21 257 431 7.8e-39 PFAM
Blast:CBS 455 505 3e-14 BLAST
Pfam:CBS 514 578 7.6e-6 PFAM
Blast:cNMP 649 805 2e-49 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000099373
SMART Domains Protein: ENSMUSP00000096972
Gene: ENSMUSG00000064105

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 41 54 N/A INTRINSIC
low complexity region 56 67 N/A INTRINSIC
low complexity region 194 227 N/A INTRINSIC
Pfam:DUF21 257 431 2.6e-39 PFAM
Blast:CBS 455 505 3e-14 BLAST
Pfam:CBS 514 578 1.1e-5 PFAM
Blast:cNMP 649 827 1e-46 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ancient conserved domain containing protein family. Members of this protein family contain a cyclin box motif and have structural similarity to the cyclins. The encoded protein may play an important role in magnesium homeostasis by mediating the epithelial transport and renal reabsorption of Mg2+. Mutations in this gene are associated with renal hypomagnesemia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
Allele List at MGI

All alleles(90) : Gene trapped(90)

Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A T 11: 110,083,500 S203T probably damaging Het
Adat1 A T 8: 111,989,862 M76K probably damaging Het
Ankrd33 G C 15: 101,116,899 V56L probably benign Het
Ascc3 T A 10: 50,716,629 L1134I possibly damaging Het
C3 T G 17: 57,217,286 D948A probably damaging Het
Ccdc40 A G 11: 119,231,786 E138G possibly damaging Het
Cd80 A G 16: 38,486,504 probably null Het
Cdca7 T A 2: 72,479,529 probably null Het
Chit1 A G 1: 134,151,292 S447G probably benign Het
Cmya5 C T 13: 93,069,278 probably null Het
Col1a2 T C 6: 4,534,639 L881P unknown Het
Crebbp A T 16: 4,117,323 S901T probably damaging Het
Dcun1d2 T C 8: 13,271,637 Y158C probably damaging Het
Dnhd1 C T 7: 105,720,798 P4477S probably benign Het
Donson A G 16: 91,681,330 Y428H probably damaging Het
Dsp G T 13: 38,191,740 W1167L probably benign Het
Elmo2 C T 2: 165,295,041 V592M probably damaging Het
Enpp3 T A 10: 24,826,195 E60D probably damaging Het
Fam83b TAAGA T 9: 76,502,112 probably null Het
Fbxo38 A G 18: 62,536,224 C52R probably damaging Het
Gm10912 T C 2: 104,066,710 W65R probably damaging Het
Gm43518 A T 5: 123,936,427 M44L probably benign Het
Gm4881 A T 7: 24,931,664 probably null Het
Gm6583 A C 5: 112,355,529 M103R probably benign Het
Gnb1 T A 4: 155,553,456 D212E probably damaging Het
Gnl1 A G 17: 35,988,728 N597S probably damaging Het
Gprin1 T G 13: 54,739,042 E473A probably benign Het
Ighv1-69 T A 12: 115,623,214 M100L probably benign Het
Igkv14-100 T C 6: 68,519,209 S29P probably damaging Het
Ints6 A G 14: 62,714,337 V232A probably damaging Het
Jup A G 11: 100,379,553 L376P probably damaging Het
Kdr A T 5: 75,972,260 Y119* probably null Het
Kif1a T G 1: 93,066,098 T377P probably benign Het
Lama5 C A 2: 180,180,731 V2850L probably damaging Het
Lrp2 T C 2: 69,483,208 Y2393C probably damaging Het
Mfsd13a C T 19: 46,368,324 Q255* probably null Het
Msh3 A C 13: 92,235,588 D891E probably damaging Het
Msl2 A G 9: 101,075,282 N2D possibly damaging Het
Myo19 T C 11: 84,900,547 L476P probably damaging Het
Nbeal2 G A 9: 110,638,618 R501W probably damaging Het
Nfasc C A 1: 132,621,049 K293N probably damaging Het
Npbwr1 A T 1: 5,917,100 L65Q probably damaging Het
Nrbp1 T A 5: 31,244,481 D34E probably damaging Het
Nup205 T A 6: 35,243,936 V1891D probably benign Het
Olfr172 T C 16: 58,761,119 N19S probably benign Het
Olfr577 T A 7: 102,973,968 N8I possibly damaging Het
Olfr936 G T 9: 39,047,083 C156* probably null Het
Olfr998 T A 2: 85,590,598 D19E probably benign Het
Oscp1 G A 4: 126,082,990 probably null Het
Pcdhgb7 A G 18: 37,753,033 T419A probably damaging Het
Pdzph1 T C 17: 58,974,126 D387G probably benign Het
Phc1 A G 6: 122,335,031 F56S probably damaging Het
Pik3c2g A G 6: 139,622,063 E59G possibly damaging Het
Prickle1 G T 15: 93,500,871 T692K possibly damaging Het
Rbm45 T A 2: 76,376,394 L250Q probably damaging Het
Ror1 T A 4: 100,407,911 M194K probably damaging Het
Rrbp1 T A 2: 143,957,802 probably null Het
Rundc3b T C 5: 8,512,348 K340R probably null Het
Scn1a T A 2: 66,317,899 T1101S probably damaging Het
Sdk1 C G 5: 142,094,657 probably null Het
Skiv2l A G 17: 34,845,207 F501S possibly damaging Het
Slc20a1 T A 2: 129,200,059 M114K probably damaging Het
Sorl1 A C 9: 41,969,751 I2158S probably benign Het
Strip1 A T 3: 107,626,795 F174L probably benign Het
Sucnr1 A T 3: 60,086,278 I76L probably benign Het
Syt17 C T 7: 118,408,019 V412I probably benign Het
Tie1 T A 4: 118,489,653 H18L probably benign Het
Tpp1 T G 7: 105,748,922 K345Q probably damaging Het
Trcg1 G A 9: 57,241,569 M141I possibly damaging Het
Trpc4ap T C 2: 155,657,822 N260S probably benign Het
Vps41 C A 13: 18,842,268 T512K possibly damaging Het
Vps52 A T 17: 33,959,319 M147L probably benign Het
Ywhaq A G 12: 21,391,751 probably benign Het
Zfp619 A G 7: 39,534,963 N139S probably benign Het
Other mutations in Cnnm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Cnnm2 APN 19 46763220 missense probably damaging 1.00
IGL01971:Cnnm2 APN 19 46871676 missense probably benign 0.19
IGL02003:Cnnm2 APN 19 46868559 missense probably damaging 1.00
IGL02068:Cnnm2 APN 19 46877388 missense possibly damaging 0.94
IGL02185:Cnnm2 APN 19 46762995 missense probably benign 0.45
IGL02652:Cnnm2 APN 19 46763211 missense probably damaging 1.00
IGL02682:Cnnm2 APN 19 46762076 missense probably benign 0.37
IGL03009:Cnnm2 APN 19 46877355 missense probably damaging 1.00
IGL03378:Cnnm2 APN 19 46878034 missense possibly damaging 0.76
R1581:Cnnm2 UTSW 19 46763123 missense probably damaging 0.99
R3700:Cnnm2 UTSW 19 46762551 missense probably damaging 1.00
R3892:Cnnm2 UTSW 19 46761793 nonsense probably null
R3911:Cnnm2 UTSW 19 46877936 missense probably damaging 0.96
R4508:Cnnm2 UTSW 19 46877270 missense probably benign 0.01
R4678:Cnnm2 UTSW 19 46763246 missense possibly damaging 0.91
R4878:Cnnm2 UTSW 19 46859083 missense probably benign 0.45
R5154:Cnnm2 UTSW 19 46763132 missense probably benign 0.02
R5445:Cnnm2 UTSW 19 46877288 missense possibly damaging 0.66
R5771:Cnnm2 UTSW 19 46856995 intron probably null
R5914:Cnnm2 UTSW 19 46763177 missense probably benign 0.07
R6263:Cnnm2 UTSW 19 46856905 missense probably benign 0.30
R6715:Cnnm2 UTSW 19 46853973 missense probably damaging 1.00
R6881:Cnnm2 UTSW 19 46877219 missense probably damaging 1.00
R7022:Cnnm2 UTSW 19 46762550 missense probably damaging 0.98
X0017:Cnnm2 UTSW 19 46762463 missense probably benign 0.05
X0018:Cnnm2 UTSW 19 46762773 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATATGGGGCAGAAACCAAC -3'
(R):5'- GTCCTGACCTGAAGAATGAGG -3'

Sequencing Primer
(F):5'- AGGGCCAGACATGACTATTCCG -3'
(R):5'- CCTGACCTGAAGAATGAGGACGAAG -3'
Posted On2019-07-03