Incidental Mutation 'R7026:Ms4a10'
ID568378
Institutional Source Beutler Lab
Gene Symbol Ms4a10
Ensembl Gene ENSMUSG00000024731
Gene Namemembrane-spanning 4-domains, subfamily A, member 10
Synonyms2010001N17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R7026 (G1)
Quality Score168.009
Status Validated
Chromosome19
Chromosomal Location10962293-10974670 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to C at 10967505 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140111 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072748] [ENSMUST00000190246] [ENSMUST00000191343]
Predicted Effect probably null
Transcript: ENSMUST00000072748
SMART Domains Protein: ENSMUSP00000072531
Gene: ENSMUSG00000024731

DomainStartEndE-ValueType
low complexity region 25 36 N/A INTRINSIC
Pfam:CD20 56 190 6e-10 PFAM
low complexity region 239 252 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190246
SMART Domains Protein: ENSMUSP00000140826
Gene: ENSMUSG00000024731

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 39 53 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000191343
SMART Domains Protein: ENSMUSP00000140111
Gene: ENSMUSG00000024731

DomainStartEndE-ValueType
low complexity region 25 36 N/A INTRINSIC
Pfam:CD20 57 150 7.9e-14 PFAM
low complexity region 199 212 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Most MS4A genes, including MS4A10, encode proteins with at least 4 potential transmembrane domains and N- and C-terminal cytoplasmic domains encoded by distinct exons.[supplied by OMIM, Apr 2004]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 A T 19: 43,816,953 M749L probably benign Het
Abcc2 A G 19: 43,830,535 N1321S probably benign Het
Acsm2 T A 7: 119,592,227 V506E probably damaging Het
Add2 G A 6: 86,086,983 R88Q probably benign Het
Adgra3 A G 5: 49,960,741 V1155A probably benign Het
Ahsg T A 16: 22,892,213 D33E probably damaging Het
Alox12b A T 11: 69,157,305 D20V possibly damaging Het
Alppl2 A G 1: 87,089,698 probably null Het
Ankfn1 A G 11: 89,639,577 *49Q probably null Het
Bcl11b T C 12: 107,916,592 D488G probably damaging Het
Bcl2l10 T A 9: 75,351,082 F175L probably benign Het
C2cd3 T A 7: 100,432,092 D127E probably damaging Het
Cacna1c C T 6: 118,637,771 V1311I probably damaging Het
Cd55b A T 1: 130,388,690 I374K probably benign Het
Cfap36 T C 11: 29,222,565 T267A probably benign Het
Cog1 T C 11: 113,649,589 L10P probably damaging Het
Dnah7a T A 1: 53,504,289 M2241L probably benign Het
Dock10 G T 1: 80,501,787 A1809E probably benign Het
Dock7 A T 4: 99,078,919 D255E probably benign Het
Exph5 T C 9: 53,340,428 F123L probably benign Het
Fam92b G A 8: 120,168,585 H193Y probably damaging Het
Fbxw27 C A 9: 109,788,078 K118N possibly damaging Het
Fscb C A 12: 64,471,617 S1025I unknown Het
Get4 C T 5: 139,252,603 R47W possibly damaging Het
Gm14409 T A 2: 177,265,568 I46F probably benign Het
Gm3676 G A 14: 41,644,115 S81F probably benign Het
Gulp1 C T 1: 44,781,085 P251S possibly damaging Het
Hhatl T C 9: 121,788,273 D298G probably benign Het
Hsf2bp T A 17: 32,033,280 K60N possibly damaging Het
Ints4 T A 7: 97,519,154 V625D possibly damaging Het
Iqch T A 9: 63,525,139 K286* probably null Het
Irak1bp1 T A 9: 82,830,031 S2T possibly damaging Het
Kdm3b G A 18: 34,822,464 V1135I possibly damaging Het
Lama3 C A 18: 12,516,548 N181K probably damaging Het
Lrfn2 T G 17: 49,096,977 S709R probably benign Het
Lrp12 T C 15: 39,880,170 H123R probably damaging Het
Lrp1b A G 2: 41,269,222 S1569P probably damaging Het
Lrp2 T G 2: 69,521,787 Q635P probably damaging Het
Mboat2 T C 12: 24,948,382 probably null Het
Mctp1 A G 13: 76,806,259 T596A probably benign Het
Mroh9 T A 1: 163,060,682 M275L probably benign Het
Myo9a C T 9: 59,815,334 R560C probably damaging Het
Olfr1348 T A 7: 6,501,821 H135L probably damaging Het
Olfr1461 A G 19: 13,165,415 T134A probably benign Het
Olfr747 A G 14: 50,681,259 I125T probably damaging Het
Ormdl3 A G 11: 98,583,982 V45A possibly damaging Het
Parp4 T C 14: 56,620,592 Y894H probably benign Het
Pigo G A 4: 43,023,380 Q259* probably null Het
Prrc2a G A 17: 35,161,827 P70S unknown Het
Rab3ip A G 10: 116,937,536 I124T probably benign Het
Rap1b A G 10: 117,818,479 I21T probably benign Het
Rasgrf2 T A 13: 91,983,613 S642C probably damaging Het
Rb1 T C 14: 73,298,099 E106G probably benign Het
Reps1 C A 10: 18,107,689 R427S probably damaging Het
Rnf213 A C 11: 119,479,655 H4760P possibly damaging Het
Rtl1 A G 12: 109,593,161 I748T probably damaging Het
Sco1 A T 11: 67,053,857 K102M probably damaging Het
Sec16b T C 1: 157,534,711 M44T possibly damaging Het
Slc7a10 T C 7: 35,198,714 M297T probably damaging Het
Smchd1 T C 17: 71,349,667 H1935R probably benign Het
Sowaha G A 11: 53,479,223 R229W probably damaging Het
Sptlc3 A T 2: 139,537,688 M83L probably benign Het
Tbc1d9 T C 8: 83,241,563 V431A probably benign Het
Tmem98 A G 11: 80,821,388 E217G possibly damaging Het
Trim13 T A 14: 61,605,113 L193* probably null Het
Trp53bp2 T C 1: 182,442,735 S367P probably benign Het
Tsc2 T G 17: 24,626,739 I202L probably damaging Het
Twf2 T A 9: 106,214,880 V312E probably damaging Het
Usp34 G T 11: 23,361,622 L471F probably damaging Het
Vps37c A G 19: 10,706,268 D18G probably damaging Het
Other mutations in Ms4a10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01901:Ms4a10 APN 19 10963010 missense probably benign
IGL03031:Ms4a10 APN 19 10968671 missense probably benign 0.01
P0027:Ms4a10 UTSW 19 10964128 missense probably damaging 0.99
R0863:Ms4a10 UTSW 19 10968593 missense probably damaging 1.00
R1456:Ms4a10 UTSW 19 10964733 missense possibly damaging 0.91
R1509:Ms4a10 UTSW 19 10964108 missense probably benign 0.01
R1838:Ms4a10 UTSW 19 10964047 missense possibly damaging 0.92
R4583:Ms4a10 UTSW 19 10968189 missense possibly damaging 0.94
R4932:Ms4a10 UTSW 19 10964768 missense probably damaging 1.00
R5548:Ms4a10 UTSW 19 10968120 critical splice donor site probably null
R5819:Ms4a10 UTSW 19 10968690 missense probably benign 0.00
R5952:Ms4a10 UTSW 19 10964122 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGATTGAGCAAGCCCAC -3'
(R):5'- AGGATCCATACTCCTCCGAG -3'

Sequencing Primer
(F):5'- TTCATGCAGGTCACAGCTAG -3'
(R):5'- GAGACTCCAGGGCACTATCCTAG -3'
Posted On2019-07-11