Incidental Mutation 'R7016:Smarcc2'
ID568406
Institutional Source Beutler Lab
Gene Symbol Smarcc2
Ensembl Gene ENSMUSG00000025369
Gene NameSWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 2
Synonyms5930405J04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.902) question?
Stock #R7016 (G1)
Quality Score93.0077
Status Validated
Chromosome10
Chromosomal Location128459248-128490482 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to G at 128485329 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151333 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026433] [ENSMUST00000099131] [ENSMUST00000105235] [ENSMUST00000218228]
Predicted Effect probably null
Transcript: ENSMUST00000026433
SMART Domains Protein: ENSMUSP00000026433
Gene: ENSMUSG00000025369

DomainStartEndE-ValueType
low complexity region 48 64 N/A INTRINSIC
CHROMO 186 235 5.97e-6 SMART
low complexity region 297 307 N/A INTRINSIC
Pfam:SWIRM 424 512 4.9e-38 PFAM
low complexity region 545 557 N/A INTRINSIC
SANT 597 645 9.04e-12 SMART
low complexity region 768 816 N/A INTRINSIC
low complexity region 861 879 N/A INTRINSIC
coiled coil region 906 921 N/A INTRINSIC
low complexity region 948 982 N/A INTRINSIC
low complexity region 985 1010 N/A INTRINSIC
low complexity region 1012 1062 N/A INTRINSIC
low complexity region 1074 1098 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000099131
SMART Domains Protein: ENSMUSP00000096734
Gene: ENSMUSG00000025369

DomainStartEndE-ValueType
low complexity region 48 64 N/A INTRINSIC
CHROMO 186 235 5.97e-6 SMART
low complexity region 297 307 N/A INTRINSIC
Pfam:SWIRM 424 512 3.9e-38 PFAM
SANT 628 676 9.04e-12 SMART
low complexity region 799 847 N/A INTRINSIC
low complexity region 892 910 N/A INTRINSIC
coiled coil region 937 952 N/A INTRINSIC
low complexity region 979 1013 N/A INTRINSIC
low complexity region 1016 1041 N/A INTRINSIC
low complexity region 1043 1093 N/A INTRINSIC
low complexity region 1105 1129 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000105235
SMART Domains Protein: ENSMUSP00000100868
Gene: ENSMUSG00000025369

DomainStartEndE-ValueType
low complexity region 48 64 N/A INTRINSIC
CHROMO 186 235 5.97e-6 SMART
low complexity region 297 307 N/A INTRINSIC
Pfam:SWIRM 426 512 4.5e-35 PFAM
low complexity region 545 557 N/A INTRINSIC
SANT 597 645 9.04e-12 SMART
Pfam:SWIRM-assoc_3 684 750 4.1e-34 PFAM
low complexity region 768 816 N/A INTRINSIC
Pfam:SWIRM-assoc_1 863 946 1.5e-34 PFAM
low complexity region 948 982 N/A INTRINSIC
low complexity region 985 1010 N/A INTRINSIC
low complexity region 1012 1062 N/A INTRINSIC
low complexity region 1077 1093 N/A INTRINSIC
low complexity region 1108 1123 N/A INTRINSIC
low complexity region 1153 1177 N/A INTRINSIC
low complexity region 1184 1212 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000218228
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SWI/SNF family of proteins, whose members display helicase and ATPase activities and which are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI and contains a predicted leucine zipper motif typical of many transcription factors. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted allele exhibit a slight increase in embryo weight at E13.5 and die shortly after birth (P0-P3). Mice homozygous for a conditional allele activated in the brain exhibit reduced cerebral cortical size and thickness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810043G02Rik T A 10: 77,982,956 C154S probably benign Het
Abcb4 T A 5: 8,936,843 V754D probably benign Het
Actn1 T A 12: 80,172,968 M710L possibly damaging Het
Adam1a A G 5: 121,521,038 F64S probably benign Het
Aip G T 19: 4,121,402 D11E probably benign Het
Ak7 T A 12: 105,781,679 Y714* probably null Het
Amhr2 A G 15: 102,454,364 E522G possibly damaging Het
Amotl1 A G 9: 14,593,699 L108P probably damaging Het
Arhgef17 A G 7: 100,878,977 S677P probably benign Het
Asph T C 4: 9,630,604 probably null Het
Atp11b T C 3: 35,841,036 S908P probably benign Het
Atp13a3 C A 16: 30,338,490 V903L possibly damaging Het
Bcam G A 7: 19,758,443 R576* probably null Het
Btbd2 A G 10: 80,648,615 S141P probably damaging Het
Cacna1b T C 2: 24,762,848 N67S possibly damaging Het
Cc2d2b A G 19: 40,795,804 T872A possibly damaging Het
Ccdc24 T A 4: 117,871,116 I144F probably null Het
Cep44 A T 8: 56,544,199 F101L possibly damaging Het
Disp1 C A 1: 183,087,466 R1130L probably damaging Het
Dnajc21 G T 15: 10,461,407 Y152* probably null Het
Edem2 A G 2: 155,716,072 F214L possibly damaging Het
Fam118b G A 9: 35,223,718 R198W probably damaging Het
Fam208b A T 13: 3,576,857 V1031E possibly damaging Het
Fgb A G 3: 83,046,064 V133A probably benign Het
Fsip2 A G 2: 82,990,635 T5571A probably benign Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,817 probably benign Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,266,277 probably benign Het
Hjurp TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTGCT TCT 1: 88,266,278 probably benign Het
Hnf4a T A 2: 163,564,273 Y277N probably damaging Het
Htatip2 A G 7: 49,770,835 D143G possibly damaging Het
Itgae A G 11: 73,119,516 N611D probably damaging Het
Ksr1 A T 11: 79,027,536 N515K probably damaging Het
Lrp1 C A 10: 127,559,967 probably null Het
Map3k20 T A 2: 72,378,635 V195D probably damaging Het
Meox2 A G 12: 37,109,224 S132G probably benign Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Nell2 T A 15: 95,229,151 N781I possibly damaging Het
Odf3l2 T C 10: 79,639,956 Y258C probably damaging Het
Olfr106-ps G A 17: 37,395,203 G221D possibly damaging Het
Olfr513 A G 7: 108,755,711 N285S probably damaging Het
Olfr535 A G 7: 140,493,240 T201A probably benign Het
Olfr631 A G 7: 103,929,530 I236V probably benign Het
Otoa A T 7: 121,147,766 Q918L probably damaging Het
Palld T G 8: 61,515,998 K1022T probably damaging Het
Parp8 A T 13: 116,895,091 S362T probably damaging Het
Phrf1 A G 7: 141,237,563 E95G probably damaging Het
Pls1 A T 9: 95,786,941 F76I probably damaging Het
Pnp T A 14: 50,950,249 probably null Het
Ptdss1 A C 13: 66,972,621 M294L probably benign Het
Rictor T A 15: 6,774,880 probably null Het
Rilp A G 11: 75,510,919 E175G probably damaging Het
Serpina16 T A 12: 103,675,371 T32S probably benign Het
Sim1 C T 10: 50,984,250 S736L probably benign Het
Smtn A G 11: 3,530,368 probably null Het
Sspo T A 6: 48,449,164 W98R probably damaging Het
St8sia3 A T 18: 64,269,583 I98F probably benign Het
Taf10 A T 7: 105,743,998 probably null Het
Tbc1d4 T A 14: 101,487,441 N580I probably damaging Het
Trim12c A T 7: 104,348,206 C48S Het
Tsc22d1 C A 14: 76,417,542 T405K probably damaging Het
Tubgcp5 A G 7: 55,794,229 D2G possibly damaging Het
Wwc2 T C 8: 47,847,548 E960G unknown Het
Yme1l1 T A 2: 23,186,355 probably null Het
Zbtb2 G C 10: 4,368,646 P460R probably damaging Het
Zfp62 T G 11: 49,215,937 I285S probably damaging Het
Other mutations in Smarcc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00496:Smarcc2 APN 10 128463055 missense probably damaging 0.97
IGL01450:Smarcc2 APN 10 128469320 missense probably damaging 1.00
IGL01638:Smarcc2 APN 10 128488074 unclassified probably benign
IGL01663:Smarcc2 APN 10 128488977 unclassified probably benign
IGL02308:Smarcc2 APN 10 128482772 missense probably damaging 1.00
IGL02511:Smarcc2 APN 10 128461382 missense probably damaging 1.00
IGL02633:Smarcc2 APN 10 128469687 missense probably damaging 1.00
IGL03375:Smarcc2 APN 10 128482912 missense probably damaging 0.99
IGL03493:Smarcc2 APN 10 128461357 missense probably damaging 1.00
PIT4403001:Smarcc2 UTSW 10 128463024 missense probably damaging 1.00
R0220:Smarcc2 UTSW 10 128483636 missense probably benign 0.32
R0281:Smarcc2 UTSW 10 128474722 missense probably benign 0.20
R1299:Smarcc2 UTSW 10 128461378 missense probably damaging 1.00
R1447:Smarcc2 UTSW 10 128469791 critical splice donor site probably null
R1466:Smarcc2 UTSW 10 128474245 missense probably damaging 0.98
R1466:Smarcc2 UTSW 10 128474245 missense probably damaging 0.98
R1498:Smarcc2 UTSW 10 128482192 missense probably benign 0.02
R1499:Smarcc2 UTSW 10 128463872 missense probably damaging 0.99
R1616:Smarcc2 UTSW 10 128482793 missense probably damaging 1.00
R1718:Smarcc2 UTSW 10 128468998 intron probably benign
R1767:Smarcc2 UTSW 10 128469082 missense possibly damaging 0.92
R1792:Smarcc2 UTSW 10 128463871 missense probably damaging 1.00
R1965:Smarcc2 UTSW 10 128474758 missense probably damaging 1.00
R2229:Smarcc2 UTSW 10 128488341 unclassified probably benign
R2286:Smarcc2 UTSW 10 128463743 missense possibly damaging 0.58
R2367:Smarcc2 UTSW 10 128482167 missense possibly damaging 0.86
R2398:Smarcc2 UTSW 10 128469682 missense possibly damaging 0.92
R3084:Smarcc2 UTSW 10 128488159 unclassified probably benign
R3085:Smarcc2 UTSW 10 128488159 unclassified probably benign
R3777:Smarcc2 UTSW 10 128482943 critical splice donor site probably null
R4346:Smarcc2 UTSW 10 128468823 missense probably benign 0.02
R4967:Smarcc2 UTSW 10 128483180 missense probably damaging 0.99
R4992:Smarcc2 UTSW 10 128474710 missense probably damaging 0.99
R5028:Smarcc2 UTSW 10 128461445 missense probably damaging 0.99
R5071:Smarcc2 UTSW 10 128463940 missense probably damaging 1.00
R5095:Smarcc2 UTSW 10 128469300 missense probably damaging 0.99
R5133:Smarcc2 UTSW 10 128461473 critical splice donor site probably null
R5180:Smarcc2 UTSW 10 128487362 unclassified probably benign
R5231:Smarcc2 UTSW 10 128461352 missense probably damaging 1.00
R5240:Smarcc2 UTSW 10 128481006 critical splice donor site probably null
R5401:Smarcc2 UTSW 10 128465504 missense probably damaging 1.00
R5445:Smarcc2 UTSW 10 128488074 unclassified probably benign
R5690:Smarcc2 UTSW 10 128484407 missense probably damaging 1.00
R5694:Smarcc2 UTSW 10 128484127 missense probably benign
R6240:Smarcc2 UTSW 10 128488024 unclassified probably benign
R6545:Smarcc2 UTSW 10 128484128 missense probably benign 0.00
R6713:Smarcc2 UTSW 10 128487769 intron probably null
R6934:Smarcc2 UTSW 10 128469672 missense probably benign 0.27
R7149:Smarcc2 UTSW 10 128482729 missense probably damaging 1.00
R7229:Smarcc2 UTSW 10 128488048 missense unknown
Z1088:Smarcc2 UTSW 10 128461434 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTGTTTCCAGCCCTTTAATTT -3'
(R):5'- TAGCCAGAGTGCTCAGCTG -3'

Sequencing Primer
(F):5'- CTGGGAATTGAACTCAGGACCTTC -3'
(R):5'- GAGTGCTCAGCTGCAAAAACTC -3'
Posted On2019-07-17