Incidental Mutation 'R7184:Zscan10'
ID568569
Institutional Source Beutler Lab
Gene Symbol Zscan10
Ensembl Gene ENSMUSG00000023902
Gene Namezinc finger and SCAN domain containing 10
SynonymsZscan10, Zfp206
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_001033425.3; MGI:3040700

Is this an essential gene? Probably non essential (E-score: 0.245) question?
Stock #R7184 (G1)
Quality Score143.008
Status Validated
Chromosome17
Chromosomal Location23600856-23611019 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 23607029 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120876 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095595] [ENSMUST00000115509] [ENSMUST00000117606] [ENSMUST00000118369] [ENSMUST00000120967] [ENSMUST00000122285] [ENSMUST00000123866] [ENSMUST00000129227] [ENSMUST00000138487] [ENSMUST00000148062]
Predicted Effect probably null
Transcript: ENSMUST00000095595
SMART Domains Protein: ENSMUSP00000093255
Gene: ENSMUSG00000023902

DomainStartEndE-ValueType
SCAN 39 145 1.28e-34 SMART
low complexity region 173 194 N/A INTRINSIC
ZnF_C2H2 343 366 4.4e-2 SMART
ZnF_C2H2 378 400 5.59e-4 SMART
ZnF_C2H2 406 428 1.25e-1 SMART
ZnF_C2H2 434 456 2.05e-2 SMART
ZnF_C2H2 478 500 2.75e-3 SMART
low complexity region 507 521 N/A INTRINSIC
ZnF_C2H2 524 547 1.82e-3 SMART
ZnF_C2H2 553 575 3.16e-3 SMART
ZnF_C2H2 581 603 1.95e-3 SMART
ZnF_C2H2 609 631 4.17e-3 SMART
ZnF_C2H2 637 659 1.56e-2 SMART
ZnF_C2H2 665 687 2.4e-3 SMART
ZnF_C2H2 693 715 1.98e-4 SMART
ZnF_C2H2 726 748 1.58e-3 SMART
ZnF_C2H2 754 776 6.42e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115509
SMART Domains Protein: ENSMUSP00000111171
Gene: ENSMUSG00000023902

DomainStartEndE-ValueType
SCAN 39 148 3.37e-34 SMART
ZnF_C2H2 233 256 4.4e-2 SMART
ZnF_C2H2 268 290 5.59e-4 SMART
ZnF_C2H2 296 318 1.25e-1 SMART
ZnF_C2H2 324 346 2.05e-2 SMART
ZnF_C2H2 368 390 2.75e-3 SMART
low complexity region 397 411 N/A INTRINSIC
ZnF_C2H2 414 437 1.82e-3 SMART
ZnF_C2H2 443 465 3.16e-3 SMART
ZnF_C2H2 471 493 1.95e-3 SMART
ZnF_C2H2 499 521 4.17e-3 SMART
ZnF_C2H2 527 549 1.56e-2 SMART
ZnF_C2H2 555 577 2.4e-3 SMART
ZnF_C2H2 583 605 1.98e-4 SMART
ZnF_C2H2 616 638 1.58e-3 SMART
ZnF_C2H2 644 666 6.42e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117606
SMART Domains Protein: ENSMUSP00000112460
Gene: ENSMUSG00000023902

DomainStartEndE-ValueType
SCAN 39 147 1.73e-31 SMART
Predicted Effect probably null
Transcript: ENSMUST00000118369
SMART Domains Protein: ENSMUSP00000113757
Gene: ENSMUSG00000023902

DomainStartEndE-ValueType
SCAN 39 152 1.59e-30 SMART
Predicted Effect probably null
Transcript: ENSMUST00000120967
SMART Domains Protein: ENSMUSP00000113386
Gene: ENSMUSG00000023902

DomainStartEndE-ValueType
SCAN 39 145 1.28e-34 SMART
low complexity region 173 194 N/A INTRINSIC
ZnF_C2H2 346 368 5.59e-4 SMART
ZnF_C2H2 374 396 1.25e-1 SMART
ZnF_C2H2 402 424 2.05e-2 SMART
ZnF_C2H2 446 468 2.75e-3 SMART
low complexity region 475 489 N/A INTRINSIC
ZnF_C2H2 492 515 1.82e-3 SMART
ZnF_C2H2 521 543 3.16e-3 SMART
ZnF_C2H2 549 571 1.95e-3 SMART
ZnF_C2H2 577 599 4.17e-3 SMART
ZnF_C2H2 605 627 1.56e-2 SMART
ZnF_C2H2 633 655 2.4e-3 SMART
ZnF_C2H2 661 683 1.98e-4 SMART
ZnF_C2H2 694 716 1.58e-3 SMART
ZnF_C2H2 722 744 6.42e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122285
SMART Domains Protein: ENSMUSP00000112559
Gene: ENSMUSG00000023902

DomainStartEndE-ValueType
SCAN 39 152 1.59e-30 SMART
Predicted Effect probably null
Transcript: ENSMUST00000123866
SMART Domains Protein: ENSMUSP00000116748
Gene: ENSMUSG00000023902

DomainStartEndE-ValueType
SCAN 39 148 2.38e-34 SMART
ZnF_C2H2 267 290 4.4e-2 SMART
ZnF_C2H2 302 324 5.59e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000129227
SMART Domains Protein: ENSMUSP00000118987
Gene: ENSMUSG00000023902

DomainStartEndE-ValueType
ZnF_C2H2 142 164 5.59e-4 SMART
ZnF_C2H2 170 192 1.25e-1 SMART
ZnF_C2H2 198 220 2.05e-2 SMART
ZnF_C2H2 242 264 2.75e-3 SMART
low complexity region 271 285 N/A INTRINSIC
ZnF_C2H2 288 311 1.82e-3 SMART
ZnF_C2H2 317 339 3.16e-3 SMART
ZnF_C2H2 345 367 1.95e-3 SMART
ZnF_C2H2 373 395 4.17e-3 SMART
ZnF_C2H2 401 423 1.56e-2 SMART
ZnF_C2H2 429 451 2.4e-3 SMART
ZnF_C2H2 457 479 1.98e-4 SMART
ZnF_C2H2 490 512 1.58e-3 SMART
ZnF_C2H2 518 540 6.42e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138487
SMART Domains Protein: ENSMUSP00000114341
Gene: ENSMUSG00000023902

DomainStartEndE-ValueType
SCAN 39 148 3.37e-34 SMART
ZnF_C2H2 236 258 5.59e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000148062
SMART Domains Protein: ENSMUSP00000120876
Gene: ENSMUSG00000023902

DomainStartEndE-ValueType
Pfam:SCAN 37 88 7.5e-20 PFAM
low complexity region 128 149 N/A INTRINSIC
ZnF_C2H2 301 323 5.59e-4 SMART
ZnF_C2H2 329 351 1.25e-1 SMART
ZnF_C2H2 357 379 2.05e-2 SMART
ZnF_C2H2 401 423 2.75e-3 SMART
low complexity region 430 444 N/A INTRINSIC
ZnF_C2H2 447 470 1.82e-3 SMART
ZnF_C2H2 476 498 3.16e-3 SMART
ZnF_C2H2 504 526 1.95e-3 SMART
ZnF_C2H2 532 554 4.17e-3 SMART
ZnF_C2H2 560 582 1.56e-2 SMART
ZnF_C2H2 588 610 2.4e-3 SMART
ZnF_C2H2 616 638 1.98e-4 SMART
ZnF_C2H2 649 671 1.58e-3 SMART
ZnF_C2H2 677 699 6.42e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (63/63)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele exhibit a pleiotropic phenotype including reduced weight, mild hypoplasia in the spleen, heart and long bones, eye malformations including microphthalmia, altered platelet counts, an activated immune status, and behavioral alterations. [provided by MGI curators]
Allele List at MGI

All alleles(357) : Targeted(5) Gene trapped(352)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik T C 1: 93,154,515 N294S probably benign Het
Aass A G 6: 23,094,220 S500P possibly damaging Het
Aldh9a1 T A 1: 167,357,396 N292K probably benign Het
Art2b A T 7: 101,580,451 S80R probably benign Het
Atp6v1b2 G T 8: 69,102,567 A194S possibly damaging Het
Bsnd T C 4: 106,491,912 M44V probably damaging Het
Cadps2 A T 6: 23,583,429 V383E probably benign Het
Cd93 T C 2: 148,442,539 T296A possibly damaging Het
Cdk15 G T 1: 59,265,655 E138D probably benign Het
Cdon A G 9: 35,463,895 I406V probably benign Het
Cyp3a41a A G 5: 145,705,853 V232A probably benign Het
Dbndd1 T A 8: 123,509,121 D130V probably damaging Het
Dnah14 C T 1: 181,704,529 R2294* probably null Het
Eddm3b A G 14: 51,116,930 Y125C probably damaging Het
Enah A T 1: 181,922,392 V294E probably damaging Het
Farp2 A G 1: 93,603,415 E545G probably damaging Het
Farsb T C 1: 78,482,357 E22G possibly damaging Het
Fezf1 A G 6: 23,247,836 V80A probably benign Het
Fpr2 T C 17: 17,893,271 Y39H unknown Het
Fsd1l C A 4: 53,694,054 R344S probably damaging Het
Fuk G A 8: 110,887,156 P758S probably damaging Het
Fxyd1 G T 7: 31,051,976 R90S unknown Het
Galnt4 T A 10: 99,108,604 Y64N probably damaging Het
Gatb C T 3: 85,636,951 Q409* probably null Het
Glipr2 A C 4: 43,968,667 D73A possibly damaging Het
Gm2035 G A 12: 87,919,722 R46W possibly damaging Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,713 probably benign Het
Gm4788 A G 1: 139,733,084 V622A possibly damaging Het
Gpr88 C T 3: 116,251,994 V223I possibly damaging Het
Gtf2h3 A G 5: 124,584,004 N55S probably benign Het
Htr4 T A 18: 62,437,427 C184* probably null Het
Ighv6-3 T A 12: 114,391,855 R71S probably benign Het
Itpr2 G C 6: 146,311,087 I1510M possibly damaging Het
Keap1 T C 9: 21,233,838 Q292R probably benign Het
Malt1 A C 18: 65,447,693 E219D probably benign Het
Manba T C 3: 135,523,154 V279A possibly damaging Het
Map4k5 T A 12: 69,874,321 H41L probably benign Het
Mcm2 T G 6: 88,891,794 Y327S probably damaging Het
Nectin3 A G 16: 46,395,121 I503T possibly damaging Het
Nqo1 T C 8: 107,392,647 I99M probably damaging Het
Nrxn2 A G 19: 6,490,552 H845R probably damaging Het
Otogl C T 10: 107,763,200 C2254Y probably damaging Het
Pmm1 T C 15: 81,956,214 N110S probably damaging Het
Poc1b G T 10: 99,134,337 C68F probably benign Het
Polr1b A G 2: 129,123,922 Y828C possibly damaging Het
Prl3d1 A G 13: 27,098,636 H119R probably damaging Het
Pum3 A G 19: 27,426,012 S30P probably benign Het
Rgl2 T C 17: 33,934,990 F457L possibly damaging Het
Rusc1 T C 3: 89,091,887 E196G possibly damaging Het
Sf3a3 A G 4: 124,714,979 K29E probably benign Het
Slc13a1 A T 6: 24,092,312 I475K probably damaging Het
Slc26a5 G T 5: 21,837,246 Y237* probably null Het
Slc7a14 C T 3: 31,227,063 G366D probably damaging Het
Tbc1d5 A G 17: 50,800,082 V482A probably benign Het
Tdrd5 G T 1: 156,259,935 Q883K probably benign Het
Tet2 T C 3: 133,473,630 Y1258C probably damaging Het
Upf2 A G 2: 6,023,320 D739G unknown Het
Vmn1r122 A T 7: 21,133,895 F78L probably benign Het
Vmn1r75 A T 7: 11,880,988 K216* probably null Het
Vmn2r11 A T 5: 109,053,415 Y408N probably damaging Het
Wscd1 T A 11: 71,788,717 V472D probably damaging Het
Zdbf2 G T 1: 63,306,505 V1348F possibly damaging Het
Zfp442 G T 2: 150,408,136 H615Q possibly damaging Het
Zfp457 C A 13: 67,294,001 C170F possibly damaging Het
Other mutations in Zscan10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Zscan10 APN 17 23609461 missense probably damaging 0.98
IGL01353:Zscan10 APN 17 23609600 missense probably damaging 1.00
IGL02327:Zscan10 APN 17 23607572 splice site probably benign
IGL02556:Zscan10 APN 17 23608145 missense possibly damaging 0.90
FR4737:Zscan10 UTSW 17 23609445 small deletion probably benign
P0043:Zscan10 UTSW 17 23609620 nonsense probably null
R0345:Zscan10 UTSW 17 23610082 missense probably damaging 1.00
R0401:Zscan10 UTSW 17 23605915 missense probably damaging 1.00
R0699:Zscan10 UTSW 17 23608118 missense probably damaging 1.00
R0838:Zscan10 UTSW 17 23610034 missense possibly damaging 0.83
R0919:Zscan10 UTSW 17 23610007 missense probably damaging 0.99
R1940:Zscan10 UTSW 17 23609852 missense probably damaging 1.00
R4647:Zscan10 UTSW 17 23610340 missense probably benign
R4753:Zscan10 UTSW 17 23607234 missense probably damaging 0.99
R4971:Zscan10 UTSW 17 23607173 missense possibly damaging 0.67
R5110:Zscan10 UTSW 17 23609632 missense probably damaging 1.00
R5410:Zscan10 UTSW 17 23610421 missense probably damaging 1.00
R5516:Zscan10 UTSW 17 23609359 missense possibly damaging 0.66
R5871:Zscan10 UTSW 17 23607267 intron probably benign
R6109:Zscan10 UTSW 17 23607129 missense probably damaging 0.98
R6626:Zscan10 UTSW 17 23605857 missense probably damaging 1.00
R6750:Zscan10 UTSW 17 23607190 missense possibly damaging 0.49
R6846:Zscan10 UTSW 17 23605607 missense probably damaging 0.97
R7223:Zscan10 UTSW 17 23609482 missense probably benign 0.00
R7436:Zscan10 UTSW 17 23610005 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- AGGGCTTAACCTGGATCAAACC -3'
(R):5'- GGATGTAGGGCTGGAATCTC -3'

Sequencing Primer
(F):5'- ACCATTAACTGTGTGTGCATGC -3'
(R):5'- GGAATCTCTTCTGAGGGCAACTC -3'
Posted On2019-08-23