Incidental Mutation 'R7159:Trpm4'
ID568630
Institutional Source Beutler Lab
Gene Symbol Trpm4
Ensembl Gene ENSMUSG00000038260
Gene Nametransient receptor potential cation channel, subfamily M, member 4
SynonymsLTRPC4, TRPM4B, 1110030C19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.170) question?
Stock #R7159 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location45302632-45333780 bp(-) (GRCm38)
Type of Mutationsplice site (4 bp from exon)
DNA Base Change (assembly) T to C at 45327268 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000040367 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042194] [ENSMUST00000210541] [ENSMUST00000211431] [ENSMUST00000211743]
Predicted Effect probably null
Transcript: ENSMUST00000042194
SMART Domains Protein: ENSMUSP00000040367
Gene: ENSMUSG00000038260

DomainStartEndE-ValueType
low complexity region 118 131 N/A INTRINSIC
SCOP:d1awcb_ 378 465 2e-3 SMART
low complexity region 600 612 N/A INTRINSIC
low complexity region 637 645 N/A INTRINSIC
transmembrane domain 688 710 N/A INTRINSIC
Pfam:Ion_trans 781 1051 1.8e-13 PFAM
low complexity region 1089 1096 N/A INTRINSIC
low complexity region 1191 1208 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000210541
Predicted Effect probably benign
Transcript: ENSMUST00000211431
Predicted Effect probably benign
Transcript: ENSMUST00000211743
Meta Mutation Damage Score 0.5856 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (70/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a calcium-activated nonselective ion channel that mediates transport of monovalent cations across membranes, thereby depolarizing the membrane. The activity of the encoded protein increases with increasing intracellular calcium concentration, but this channel does not transport calcium. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a knock-out allele display increased Ca2+ influx and IgE-dependent mast cell activation, increased vascular permeability, and enhanced acute anaphylactic responses. Mice homozygous for a different knock-out allele show Ca2+ overload and impaired dendritic cell migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap13 T A 7: 75,730,579 V500E possibly damaging Het
Ankrd34b T C 13: 92,439,462 S401P probably benign Het
Arfgef2 T A 2: 166,826,928 D41E probably benign Het
Arid1a T C 4: 133,753,568 N15S unknown Het
Arsa A T 15: 89,474,718 probably null Het
B3gnt9 C A 8: 105,254,432 C108F probably damaging Het
Bbc3 C A 7: 16,313,808 Y152* probably null Het
Btbd1 T C 7: 81,818,209 M188V probably benign Het
Caln1 C T 5: 130,822,997 T209I probably benign Het
Casp12 C T 9: 5,353,763 P266S possibly damaging Het
Ccm2l A T 2: 153,070,867 I109F probably damaging Het
Chst15 A C 7: 132,270,258 L98R probably damaging Het
Ctsq A G 13: 61,038,923 M89T probably benign Het
Ddx39b T C 17: 35,247,010 V169A probably benign Het
Ddx58 A G 4: 40,213,804 V618A probably benign Het
Fam57b T C 7: 126,827,495 F80S probably damaging Het
Fhad1 T C 4: 141,951,616 H583R probably benign Het
Fndc1 T A 17: 7,800,931 I139F probably damaging Het
Gm5724 T A 6: 141,773,778 M1L probably damaging Het
Gm7145 C G 1: 117,985,831 H148D probably benign Het
Gpr62 C A 9: 106,465,442 A96S probably damaging Het
Gsap T A 5: 21,270,620 probably null Het
Hdhd5 T A 6: 120,523,471 T89S probably damaging Het
Kcna5 T A 6: 126,533,629 Y512F probably damaging Het
Krt84 C A 15: 101,529,609 E304* probably null Het
Krt9 TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC 11: 100,189,077 probably benign Het
Lrp6 C A 6: 134,507,551 V370L probably benign Het
Lrrc3c G A 11: 98,599,318 G167D probably damaging Het
Man2b1 C T 8: 85,087,280 T291M probably benign Het
Mapkbp1 A G 2: 120,025,132 E1438G possibly damaging Het
Med12l A G 3: 59,276,017 T1947A probably benign Het
Myh15 A T 16: 49,061,574 T60S probably damaging Het
Myo5a A T 9: 75,171,563 I868F probably benign Het
Myom3 A T 4: 135,808,851 I1278F probably damaging Het
Nbn G T 4: 15,983,677 probably null Het
Ncam2 G T 16: 81,490,374 S392I probably damaging Het
Nrg3 A C 14: 38,370,735 L647* probably null Het
Olfr1062 T A 2: 86,423,612 probably null Het
Olfr1393 A T 11: 49,280,358 D70V probably damaging Het
Olfr1406 A T 1: 173,184,323 L37Q possibly damaging Het
Olfr721-ps1 T C 14: 14,407,251 S8P possibly damaging Het
Pcdhb9 A G 18: 37,401,492 N180D possibly damaging Het
Pcdhga4 A G 18: 37,686,919 N507S probably damaging Het
Pdilt A G 7: 119,487,951 V492A probably benign Het
Phf12 A G 11: 78,023,540 T603A possibly damaging Het
Phox2b T A 5: 67,097,585 I174F probably benign Het
Polq A T 16: 37,062,853 Q1793L possibly damaging Het
Prmt9 T C 8: 77,555,764 F97L probably benign Het
Prpsap1 T C 11: 116,494,044 E13G probably benign Het
Ptpru A G 4: 131,819,540 L280P probably damaging Het
Pygl A T 12: 70,197,406 M587K probably benign Het
Rc3h2 T C 2: 37,409,647 S124G probably benign Het
Rdh5 A G 10: 128,918,315 I83T possibly damaging Het
Ryr2 T G 13: 11,810,908 R561S probably damaging Het
Scara3 A G 14: 65,920,780 L593P probably damaging Het
Scfd2 T C 5: 74,531,343 I93V probably benign Het
Sema4f C A 6: 82,917,883 V444L possibly damaging Het
Spata33 T C 8: 123,214,395 L61P unknown Het
Stard10 A T 7: 101,343,136 probably null Het
Stub1 T C 17: 25,832,064 I115V probably benign Het
Tmem247 C T 17: 86,918,282 T50I probably benign Het
Tnrc6b A G 15: 80,887,022 M1103V possibly damaging Het
Trim61 T C 8: 65,013,874 Y245C probably benign Het
Trip13 T C 13: 73,920,011 I284V probably benign Het
Ttn A G 2: 76,730,574 L29161S probably damaging Het
Ttn C A 2: 76,909,748 L3528F unknown Het
Ube2v2 G A 16: 15,581,084 T47I probably benign Het
Vwa5b1 C T 4: 138,575,422 A921T possibly damaging Het
Xylt1 T A 7: 117,637,602 F526Y probably damaging Het
Other mutations in Trpm4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Trpm4 APN 7 45318349 missense probably benign
IGL01327:Trpm4 APN 7 45315073 missense probably damaging 1.00
IGL02069:Trpm4 APN 7 45319294 missense probably damaging 1.00
IGL02124:Trpm4 APN 7 45310523 missense probably damaging 1.00
IGL02141:Trpm4 APN 7 45318179 splice site probably null
IGL02333:Trpm4 APN 7 45322115 missense possibly damaging 0.85
IGL02338:Trpm4 APN 7 45326998 missense probably damaging 1.00
IGL02741:Trpm4 APN 7 45318488 missense possibly damaging 0.82
R0041:Trpm4 UTSW 7 45304946 critical splice donor site probably null
R0106:Trpm4 UTSW 7 45319240 critical splice donor site probably null
R0270:Trpm4 UTSW 7 45319253 missense possibly damaging 0.45
R0279:Trpm4 UTSW 7 45322048 missense probably damaging 0.99
R0309:Trpm4 UTSW 7 45308706 missense probably damaging 1.00
R0539:Trpm4 UTSW 7 45305472 missense probably damaging 0.99
R0969:Trpm4 UTSW 7 45327907 intron probably benign
R1454:Trpm4 UTSW 7 45317056 missense probably damaging 0.99
R1512:Trpm4 UTSW 7 45315044 missense probably benign 0.07
R1579:Trpm4 UTSW 7 45308597 missense probably damaging 1.00
R1768:Trpm4 UTSW 7 45308612 missense probably damaging 0.97
R2847:Trpm4 UTSW 7 45310598 missense probably damaging 1.00
R3883:Trpm4 UTSW 7 45321998 critical splice donor site probably null
R3884:Trpm4 UTSW 7 45321998 critical splice donor site probably null
R4895:Trpm4 UTSW 7 45318058 missense probably damaging 0.98
R5056:Trpm4 UTSW 7 45308630 missense probably damaging 0.98
R5060:Trpm4 UTSW 7 45321834 missense probably damaging 1.00
R5069:Trpm4 UTSW 7 45310469 missense probably damaging 1.00
R5560:Trpm4 UTSW 7 45310332 missense probably damaging 1.00
R5783:Trpm4 UTSW 7 45310389 missense probably benign
R5874:Trpm4 UTSW 7 45327749 missense probably damaging 1.00
R6176:Trpm4 UTSW 7 45326676 missense probably damaging 1.00
R6302:Trpm4 UTSW 7 45327719 critical splice donor site probably null
R6431:Trpm4 UTSW 7 45326568 missense possibly damaging 0.79
R6762:Trpm4 UTSW 7 45304816 utr 3 prime probably benign
R6827:Trpm4 UTSW 7 45318628 missense possibly damaging 0.89
R6845:Trpm4 UTSW 7 45322329 missense possibly damaging 0.88
R6950:Trpm4 UTSW 7 45319280 missense probably damaging 0.97
R7126:Trpm4 UTSW 7 45310709 splice site probably null
R7167:Trpm4 UTSW 7 45327719 critical splice donor site probably null
R7386:Trpm4 UTSW 7 45314640 missense possibly damaging 0.47
X0018:Trpm4 UTSW 7 45314634 missense possibly damaging 0.61
X0022:Trpm4 UTSW 7 45310511 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCATGTCTCTGTTCCGGAC -3'
(R):5'- AGTTTCTCCGGCTGTCTGAC -3'

Sequencing Primer
(F):5'- GTCTGGTGGTCCCTTACAGC -3'
(R):5'- TGTCTGACCGCACGGATC -3'
Posted On2019-09-05