Incidental Mutation 'R7067:Asap3'
ID568640
Institutional Source Beutler Lab
Gene Symbol Asap3
Ensembl Gene ENSMUSG00000036995
Gene NameArfGAP with SH3 domain, ankyrin repeat and PH domain 3
SynonymsUPLC1, 9430088F20Rik, Ddefl1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R7067 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location136206365-136245216 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 136241362 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000041899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047526]
Predicted Effect probably null
Transcript: ENSMUST00000047526
SMART Domains Protein: ENSMUSP00000041899
Gene: ENSMUSG00000036995

DomainStartEndE-ValueType
low complexity region 22 29 N/A INTRINSIC
Pfam:BAR_3 32 264 5.5e-20 PFAM
PH 303 396 5.61e-17 SMART
ArfGap 425 547 8.33e-31 SMART
ANK 584 616 4.86e1 SMART
ANK 620 649 3.06e-5 SMART
low complexity region 794 806 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a subfamily of ADP-ribosylation factor(Arf) GTPase-activating proteins that contain additional ankyrin repeat and pleckstrin homology domains. The Arf GAP domain of this protein catalyzes the hydrolysis of GTP bound to Arf proteins. The encoded protein promotes cell differentiation and migration and has been implicated in cancer cell invasion. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2009]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438H23Rik T A 16: 91,056,033 S72C probably damaging Het
9330182L06Rik G T 5: 9,266,295 A9S possibly damaging Het
Abca13 A G 11: 9,291,845 D1236G probably benign Het
Abcc6 T C 7: 46,018,690 N165D probably benign Het
Aebp1 A G 11: 5,866,431 probably null Het
Anapc4 A G 5: 52,862,235 T580A probably benign Het
Apob T C 12: 8,009,423 I2602T probably damaging Het
Arap2 A G 5: 62,654,044 probably null Het
Bend4 A G 5: 67,400,268 Y402H probably damaging Het
Crtc2 A G 3: 90,260,182 N271S probably benign Het
Csf2rb2 A T 15: 78,292,494 W233R probably damaging Het
Ctgf A G 10: 24,596,975 Y261C probably benign Het
Cyp2u1 G A 3: 131,293,553 L460F probably damaging Het
Dnm3 A G 1: 162,320,971 L277P probably damaging Het
Efemp1 A T 11: 28,867,926 N135I probably damaging Het
Fsip2 T A 2: 82,980,734 S2466T possibly damaging Het
Gal3st2 C T 1: 93,874,725 A276V possibly damaging Het
Gm47985 A T 1: 151,183,490 D294V unknown Het
Golga1 A T 2: 39,047,719 D104E probably benign Het
Hnrnpr C T 4: 136,327,393 A219V probably damaging Het
Hsd3b7 T C 7: 127,800,716 probably null Het
Hspa8 T C 9: 40,804,625 I562T probably damaging Het
Htra4 C T 8: 25,033,701 V283M probably damaging Het
Il1f5 C T 2: 24,277,529 R11* probably null Het
Iqcd A G 5: 120,605,147 T325A probably damaging Het
Kif23 A T 9: 61,924,989 M624K probably benign Het
Krt25 G T 11: 99,317,383 Q340K probably benign Het
Lamp3 T A 16: 19,699,663 N275Y probably damaging Het
Lpin2 A C 17: 71,244,858 K789T possibly damaging Het
Mroh2b T C 15: 4,900,504 I24T probably benign Het
Muc16 T A 9: 18,658,251 I991F unknown Het
Ntf5 T A 7: 45,415,624 L60Q probably damaging Het
Nuak1 A G 10: 84,440,294 S22P possibly damaging Het
Obox8 T C 7: 14,333,054 T22A possibly damaging Het
Olfr1053 T A 2: 86,314,567 T240S probably damaging Het
Pde8a T C 7: 81,317,326 V405A probably benign Het
Phc2 T C 4: 128,747,141 S147P probably benign Het
Pole G T 5: 110,334,218 G142V probably damaging Het
Poli G A 18: 70,509,417 Q508* probably null Het
Repin1 T A 6: 48,597,916 L537* probably null Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Samd7 G C 3: 30,751,123 K18N probably benign Het
Slc30a2 T A 4: 134,344,218 probably null Het
Slit3 A G 11: 35,508,230 S141G probably benign Het
Spata5 C T 3: 37,431,698 Q190* probably null Het
Spon2 A G 5: 33,214,614 S283P probably damaging Het
Srgap3 A T 6: 112,757,305 probably benign Het
Syde2 A G 3: 145,988,264 D89G probably benign Het
Syne1 A G 10: 5,234,586 I4099T probably damaging Het
Syt5 T C 7: 4,543,076 D105G probably benign Het
Tlx3 C T 11: 33,203,204 G86S probably damaging Het
Trim24 A T 6: 37,957,840 probably null Het
Umodl1 G A 17: 30,982,272 V392I probably damaging Het
Unc80 C A 1: 66,646,572 T2285K possibly damaging Het
Vars G A 17: 35,011,479 V513I probably damaging Het
Vmn1r87 T A 7: 13,131,922 Q146L probably benign Het
Vmn2r62 T C 7: 42,764,878 I714V probably benign Het
Xbp1 T A 11: 5,524,275 S159T probably damaging Het
Xrn1 T A 9: 95,969,512 H194Q probably damaging Het
Zc3h4 A T 7: 16,429,051 K459* probably null Het
Zdhhc6 G A 19: 55,304,439 R292* probably null Het
Zfp383 T A 7: 29,908,646 M1K probably null Het
Zfp703 A G 8: 26,979,016 D236G probably damaging Het
Other mutations in Asap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00586:Asap3 APN 4 136206568 missense probably damaging 1.00
IGL01865:Asap3 APN 4 136236404 missense probably damaging 1.00
IGL02045:Asap3 APN 4 136227441 missense probably benign 0.01
IGL02105:Asap3 APN 4 136228474 critical splice donor site probably null
IGL02135:Asap3 APN 4 136241153 critical splice acceptor site probably null
IGL02484:Asap3 APN 4 136229457 splice site probably benign
IGL02524:Asap3 APN 4 136238616 missense probably damaging 1.00
IGL02881:Asap3 APN 4 136239237 missense probably benign 0.00
R0128:Asap3 UTSW 4 136234604 missense probably damaging 0.99
R0883:Asap3 UTSW 4 136234325 splice site probably benign
R0903:Asap3 UTSW 4 136238376 missense probably benign
R1073:Asap3 UTSW 4 136236431 missense probably damaging 1.00
R1498:Asap3 UTSW 4 136239194 missense probably benign
R1951:Asap3 UTSW 4 136227456 nonsense probably null
R1953:Asap3 UTSW 4 136227456 nonsense probably null
R3703:Asap3 UTSW 4 136241241 small insertion probably benign
R3704:Asap3 UTSW 4 136241241 small insertion probably benign
R3705:Asap3 UTSW 4 136241241 small insertion probably benign
R3754:Asap3 UTSW 4 136229455 splice site probably null
R3773:Asap3 UTSW 4 136227575 missense probably benign 0.22
R3911:Asap3 UTSW 4 136229457 splice site probably benign
R4570:Asap3 UTSW 4 136240185 missense probably damaging 0.99
R4879:Asap3 UTSW 4 136242664 missense probably benign 0.04
R5394:Asap3 UTSW 4 136241259 missense probably benign 0.00
R5497:Asap3 UTSW 4 136239222 missense probably benign 0.13
R5914:Asap3 UTSW 4 136241409 missense probably benign 0.18
R6208:Asap3 UTSW 4 136241197 missense probably benign
R6214:Asap3 UTSW 4 136241425 missense possibly damaging 0.80
R6495:Asap3 UTSW 4 136228479 splice site probably null
R6577:Asap3 UTSW 4 136238230 splice site probably null
R6823:Asap3 UTSW 4 136227572 missense possibly damaging 0.95
R7081:Asap3 UTSW 4 136241570 critical splice donor site probably null
R7471:Asap3 UTSW 4 136233646 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- ACGCAAGCCTTTGTTCTTGG -3'
(R):5'- TGTACCTCCACTGCAATGTC -3'

Sequencing Primer
(F):5'- TCTTGGCAGCTGGAGCAG -3'
(R):5'- ACTGCAATGTCCGGCTC -3'
Posted On2019-09-05