Incidental Mutation 'R7215:Ripk4'
ID568672
Institutional Source Beutler Lab
Gene Symbol Ripk4
Ensembl Gene ENSMUSG00000005251
Gene Namereceptor-interacting serine-threonine kinase 4
SynonymsAnkrd3, DIk, PKK, ANKK2, RIP4
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.251) question?
Stock #R7215 (G1)
Quality Score220.009
Status Validated
Chromosome16
Chromosomal Location97741933-97763787 bp(-) (GRCm38)
Type of Mutationsynonymous
DNA Base Change (assembly) G to A at 97747323 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000019386 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019386]
Predicted Effect probably null
Transcript: ENSMUST00000019386
SMART Domains Protein: ENSMUSP00000019386
Gene: ENSMUSG00000005251

DomainStartEndE-ValueType
Pfam:Pkinase 22 283 1.8e-47 PFAM
Pfam:Pkinase_Tyr 23 283 6e-45 PFAM
low complexity region 356 396 N/A INTRINSIC
ANK 439 468 2.58e-3 SMART
ANK 472 501 3.41e-3 SMART
ANK 505 534 7.42e-4 SMART
ANK 538 567 3.57e-6 SMART
ANK 571 601 3.85e-2 SMART
ANK 605 634 3.15e-7 SMART
ANK 638 667 5.16e-3 SMART
ANK 671 700 2.2e-6 SMART
ANK 704 734 1.68e-2 SMART
ANK 736 765 3.46e-4 SMART
Meta Mutation Damage Score 0.576 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (79/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a serine/threonine protein kinase that interacts with protein kinase C-delta. The encoded protein can also activate NFkappaB and is required for keratinocyte differentiation. This kinase undergoes autophosphorylation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene result in perinatal lethality and epithelial developmental defects. Homozygous mutant lack oral, anal, and nasal openings and display shorter hindlimbs and tail that are partially fused to the body. The skin is significantly thicker with areas of orthokeratosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik G A 13: 77,323,571 V1032M possibly damaging Het
Abca13 T A 11: 9,288,405 probably null Het
Adamts14 T A 10: 61,211,596 H739L possibly damaging Het
Adgrl3 A G 5: 81,693,550 E758G probably damaging Het
Ano3 T A 2: 110,665,932 T826S probably damaging Het
Arhgap45 C T 10: 80,025,482 T493I possibly damaging Het
Atg9b A C 5: 24,388,041 W455G probably damaging Het
Atp4a A G 7: 30,717,360 N496S possibly damaging Het
Bckdk T A 7: 127,905,110 D60E possibly damaging Het
Blmh A T 11: 76,965,899 K244* probably null Het
Btbd17 T C 11: 114,791,465 I474V possibly damaging Het
C87436 A G 6: 86,462,680 E451G possibly damaging Het
Camta1 T C 4: 151,144,737 E546G probably damaging Het
Casp1 A G 9: 5,298,523 probably null Het
Ccdc114 C T 7: 45,936,622 R148C probably damaging Het
Ccdc116 A G 16: 17,139,928 Y456H probably damaging Het
Cep350 A C 1: 155,894,707 S1812R possibly damaging Het
Chrna10 A G 7: 102,112,208 L392P possibly damaging Het
Col22a1 A T 15: 71,970,332 C434* probably null Het
Cxcl9 G A 5: 92,323,888 Q98* probably null Het
Cyp2c54 G A 19: 40,046,182 T348I probably damaging Het
Dnah7a G A 1: 53,618,350 R756C probably damaging Het
Dnajc18 T C 18: 35,681,981 T239A probably benign Het
Dnase2a A T 8: 84,909,770 probably null Het
Dpyd A G 3: 119,266,032 T793A probably benign Het
E430018J23Rik A G 7: 127,391,523 S431P probably benign Het
Edil3 T C 13: 88,822,050 probably null Het
Ehd1 T A 19: 6,297,642 I342N possibly damaging Het
Erbb4 A T 1: 68,339,460 S341T probably benign Het
Ezh1 T A 11: 101,215,299 T87S probably benign Het
Fam20b A T 1: 156,690,553 W224R probably damaging Het
Galns A T 8: 122,599,348 probably null Het
Gm13283 C T 4: 88,760,730 probably benign Het
Gm15448 C T 7: 3,822,311 C444Y unknown Het
Gm49342 A T 14: 50,944,583 M23L probably benign Het
Gm5114 T A 7: 39,411,371 H18L probably benign Het
Gpr89 A G 3: 96,880,088 W299R probably damaging Het
Hadha G T 5: 30,119,842 N755K probably benign Het
Inpp5d A T 1: 87,701,218 H620L probably benign Het
Klk1b3 T A 7: 44,200,404 probably null Het
Macf1 T C 4: 123,507,304 T663A probably damaging Het
Man1b1 A G 2: 25,350,390 N601S probably benign Het
Mbtps1 A G 8: 119,524,568 V605A possibly damaging Het
Med23 C G 10: 24,888,429 D311E probably benign Het
Myo3a G T 2: 22,245,567 D82Y possibly damaging Het
Nsd1 T A 13: 55,247,641 D1121E probably benign Het
Olfr1042 C T 2: 86,159,456 V305I probably benign Het
Olfr1221 G A 2: 89,112,501 Q4* probably null Het
Olfr918 A G 9: 38,673,447 I12T probably benign Het
Otoa T C 7: 121,118,572 V19A unknown Het
Pcdhb20 A T 18: 37,505,386 T322S probably benign Het
Pecam1 T C 11: 106,695,919 T257A probably benign Het
Pi16 G T 17: 29,319,098 probably benign Het
Pik3c2g C T 6: 139,754,863 T293M Het
Pkhd1l1 T A 15: 44,528,163 C1542S possibly damaging Het
Prrc2b G A 2: 32,229,297 G2172R probably damaging Het
Prrt1 A T 17: 34,629,703 probably null Het
Ptprb T A 10: 116,338,776 N784K possibly damaging Het
Rem1 C A 2: 152,628,149 S18R probably damaging Het
Scn8a G A 15: 101,029,830 V1397I possibly damaging Het
Setbp1 T A 18: 78,856,837 H1205L probably damaging Het
Shmt1 T C 11: 60,801,535 I132V probably damaging Het
Slc24a1 T A 9: 64,928,503 T781S unknown Het
Sncaip C T 18: 52,907,343 Q870* probably null Het
Stab1 A T 14: 31,160,797 N416K possibly damaging Het
Tcea1 A G 1: 4,867,483 D26G probably damaging Het
Tcf20 A T 15: 82,853,489 S1254T probably benign Het
Tead4 T A 6: 128,228,678 I354F probably damaging Het
Tex36 G A 7: 133,587,418 R142* probably null Het
Trav6d-3 T A 14: 52,725,342 L12Q probably damaging Het
Trpc4 A G 3: 54,194,896 T72A possibly damaging Het
Trrap G A 5: 144,797,135 A933T probably benign Het
Tspoap1 T A 11: 87,770,489 I589N probably benign Het
Ttll5 T A 12: 85,933,396 V918E probably benign Het
Txn2 A G 15: 77,927,686 probably null Het
Ucn3 T G 13: 3,941,365 T96P probably benign Het
Usp36 T C 11: 118,265,154 E764G possibly damaging Het
Vmn2r23 A T 6: 123,704,364 H77L probably benign Het
Vmn2r57 T C 7: 41,400,286 T680A probably benign Het
Vwa3a T C 7: 120,795,630 I891T possibly damaging Het
Zcchc11 T C 4: 108,527,008 Y1091H probably damaging Het
Zhx2 A G 15: 57,823,643 I803V probably benign Het
Other mutations in Ripk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Ripk4 APN 16 97751496 nonsense probably null
IGL01823:Ripk4 APN 16 97755283 missense possibly damaging 0.89
IGL01921:Ripk4 APN 16 97743365 missense possibly damaging 0.62
IGL02023:Ripk4 APN 16 97755231 missense probably damaging 1.00
IGL02201:Ripk4 APN 16 97755177 missense possibly damaging 0.91
IGL02709:Ripk4 APN 16 97743566 missense probably damaging 1.00
I2288:Ripk4 UTSW 16 97748145 missense probably benign 0.16
PIT4495001:Ripk4 UTSW 16 97743170 missense probably damaging 0.99
R0060:Ripk4 UTSW 16 97763518 splice site probably benign
R0112:Ripk4 UTSW 16 97743561 missense probably benign 0.00
R0383:Ripk4 UTSW 16 97748112 missense probably damaging 1.00
R0524:Ripk4 UTSW 16 97755287 nonsense probably null
R0540:Ripk4 UTSW 16 97744175 missense probably damaging 1.00
R0967:Ripk4 UTSW 16 97744172 missense probably damaging 1.00
R1646:Ripk4 UTSW 16 97743897 missense probably damaging 1.00
R1785:Ripk4 UTSW 16 97750131 missense probably damaging 1.00
R2058:Ripk4 UTSW 16 97744142 nonsense probably null
R2134:Ripk4 UTSW 16 97743733 missense probably damaging 1.00
R2135:Ripk4 UTSW 16 97743733 missense probably damaging 1.00
R3410:Ripk4 UTSW 16 97743957 missense probably benign 0.00
R3411:Ripk4 UTSW 16 97743957 missense probably benign 0.00
R4538:Ripk4 UTSW 16 97743152 nonsense probably null
R4627:Ripk4 UTSW 16 97744026 missense probably damaging 0.99
R4665:Ripk4 UTSW 16 97755073 missense probably damaging 0.98
R4704:Ripk4 UTSW 16 97746004 nonsense probably null
R4769:Ripk4 UTSW 16 97744062 missense probably damaging 1.00
R4860:Ripk4 UTSW 16 97751536 missense probably damaging 0.97
R4860:Ripk4 UTSW 16 97751536 missense probably damaging 0.97
R5240:Ripk4 UTSW 16 97743767 missense probably damaging 1.00
R5864:Ripk4 UTSW 16 97763582 missense probably damaging 0.98
R6027:Ripk4 UTSW 16 97744074 missense probably damaging 1.00
R6035:Ripk4 UTSW 16 97744187 missense probably damaging 1.00
R6035:Ripk4 UTSW 16 97744187 missense probably damaging 1.00
R6291:Ripk4 UTSW 16 97755123 missense probably damaging 1.00
R6343:Ripk4 UTSW 16 97763526 critical splice donor site probably null
R6572:Ripk4 UTSW 16 97745905 nonsense probably null
R6783:Ripk4 UTSW 16 97748037 missense probably damaging 1.00
R6822:Ripk4 UTSW 16 97746036 missense probably damaging 1.00
R7251:Ripk4 UTSW 16 97743249 missense probably benign
R7275:Ripk4 UTSW 16 97743957 missense probably benign 0.00
R7356:Ripk4 UTSW 16 97743149 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AATCTCTAGTGTGCTGAGCAG -3'
(R):5'- GGTATTGAGCATGTCCTCTGC -3'

Sequencing Primer
(F):5'- TGAGCAGATGGGGGTCC -3'
(R):5'- GAGCATGTCCTCTGCTGATC -3'
Posted On2019-09-06