Incidental Mutation 'R7324:Prtg'
ID568750
Institutional Source Beutler Lab
Gene Symbol Prtg
Ensembl Gene ENSMUSG00000036030
Gene Nameprotogenin
SynonymsIgdcc5, A230098A12Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.687) question?
Stock #R7324 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location72806874-72917291 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 72890840 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 696 (A696V)
Ref Sequence ENSEMBL: ENSMUSP00000055815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055535]
Predicted Effect probably damaging
Transcript: ENSMUST00000055535
AA Change: A696V

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000055815
Gene: ENSMUSG00000036030
AA Change: A696V

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IGc2 45 114 1.7e-8 SMART
IGc2 141 206 8.5e-12 SMART
IGc2 241 305 6.9e-12 SMART
IGc2 333 396 9.4e-10 SMART
FN3 413 496 8.9e-11 SMART
FN3 511 594 1.3e-10 SMART
FN3 613 693 1.5e-5 SMART
FN3 715 798 3e-10 SMART
FN3 814 898 4.4e-12 SMART
transmembrane domain 943 965 N/A INTRINSIC
low complexity region 966 976 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the immunoglobulin superfamily. The encoded transmembrane protein has been associated with the development of various tissues, especially neurogenesis. It has been suggested that this gene may be associated with attention deficit hyperactivity disorder (ADHD). [provided by RefSeq, Nov 2014]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg5 T C 17: 84,676,239 D124G possibly damaging Het
Ackr3 C G 1: 90,214,201 N127K probably damaging Het
AL732309.1 A C 2: 25,246,139 M21R possibly damaging Het
Ankrd52 C A 10: 128,386,163 T552K possibly damaging Het
Arid5b A T 10: 68,128,922 N306K probably benign Het
C1qtnf3 A C 15: 10,952,621 K56N probably benign Het
C2 C T 17: 34,881,688 G52D probably benign Het
Casz1 C T 4: 148,947,033 T1247M probably damaging Het
Cc2d2b A G 19: 40,809,108 D778G unknown Het
Cdh5 A G 8: 104,142,793 D717G probably damaging Het
Clca3a2 G A 3: 144,808,611 A445V probably damaging Het
Clca3b T A 3: 144,841,420 M319L possibly damaging Het
Csmd1 G A 8: 16,058,707 S1894L probably damaging Het
Csnk1g3 A G 18: 53,919,018 T220A probably damaging Het
Cyp2d10 T G 15: 82,403,760 T381P probably damaging Het
Ddb2 G A 2: 91,236,884 probably benign Het
Ddx24 C A 12: 103,416,259 L688F probably damaging Het
Dennd4c T C 4: 86,829,738 L1615P unknown Het
Dnah8 T A 17: 30,784,125 D3599E probably benign Het
Dst T C 1: 34,006,224 S13P possibly damaging Het
Efcab12 T C 6: 115,823,594 D156G probably benign Het
Enpp2 A G 15: 54,877,774 probably null Het
Ephx2 A G 14: 66,085,354 V490A probably damaging Het
Etnppl A G 3: 130,629,575 N308D probably damaging Het
F5 TCAGAAGACCTCCTCCCCAGACCTGGGCCAGGTGCCCCTTTCTCCAGATGACAACCAGAAGACCTCCTCCCCAGACCTGGGTCAGGTGTCCCTTTCTCCAGATGATAACCAGAAGACCTCCTCCCCAGACCTGGGTCAGGTGCCCCTTTCTCTAGATGACAACCAGAAGACGACCTCCCCAGACCTGGGTCAGGTGCCCCTTTCTCCAGATGACAACCAGA TCAGAAGACCTCCTCCCCAGACCTGGGTCAGGTGTCCCTTTCTCCAGATGATAACCAGAAGACCTCCTCCCCAGACCTGGGTCAGGTGCCCCTTTCTCTAGATGACAACCAGAAGACGACCTCCCCAGACCTGGGTCAGGTGCCCCTTTCTCCAGATGACAACCAGA 1: 164,193,581 probably benign Het
Fancl A G 11: 26,403,362 E86G probably damaging Het
Flii G A 11: 60,719,040 T615I probably benign Het
Fndc7 G T 3: 108,872,221 Q336K probably benign Het
Gm14025 T C 2: 129,037,852 D718G unknown Het
Gm26661 T C 14: 7,791,911 C109R unknown Het
H2-DMb1 T C 17: 34,159,462 probably null Het
H2-T10 C T 17: 36,119,297 G251R probably damaging Het
Harbi1 T C 2: 91,720,699 I339T probably benign Het
Hsp90aa1 A G 12: 110,695,225 M119T unknown Het
Ighe T A 12: 113,272,334 Y124F Het
Ighv7-1 T C 12: 113,896,529 Y81C probably damaging Het
Inpp5a A G 7: 139,525,670 D179G probably damaging Het
Itgad A T 7: 128,189,807 D510V probably damaging Het
Kcnn2 A T 18: 45,560,071 H238L probably benign Het
Kctd17 T A 15: 78,435,642 C189S probably damaging Het
Larp4b C A 13: 9,158,580 A423E probably benign Het
Llgl2 A G 11: 115,850,730 E562G possibly damaging Het
Macf1 T C 4: 123,374,425 T6734A probably benign Het
Maz G A 7: 127,024,593 T377M probably damaging Het
Mmrn1 G T 6: 60,944,933 G125* probably null Het
Mvp A G 7: 126,993,609 S377P probably benign Het
Nin C T 12: 70,043,734 R969Q Het
Nktr C T 9: 121,727,361 T35I probably damaging Het
Nktr T A 9: 121,748,291 M475K possibly damaging Het
Nod2 T A 8: 88,653,066 V65D probably damaging Het
Olfr1249 A T 2: 89,630,103 I265N possibly damaging Het
Olfr135 T C 17: 38,208,716 V157A probably benign Het
Olfr1487 A G 19: 13,619,578 I96V probably benign Het
Olfr1493-ps1 C T 19: 13,726,906 A215V probably benign Het
Olfr203 T C 16: 59,303,248 F32L probably benign Het
Olfr398 A G 11: 73,983,843 V255A probably benign Het
Olfr794 T A 10: 129,570,849 S65T probably damaging Het
Olfr868 A T 9: 20,101,430 I224F possibly damaging Het
Opa1 A T 16: 29,586,981 E121D probably benign Het
Osbpl2 A G 2: 180,150,201 T233A probably benign Het
Pcp4l1 G A 1: 171,174,465 A42V possibly damaging Het
Plekhh3 T A 11: 101,170,774 D38V possibly damaging Het
Ptpn14 T G 1: 189,863,424 V748G possibly damaging Het
Reg2 A T 6: 78,406,154 D28V probably benign Het
Rhpn1 A T 15: 75,704,397 I2F possibly damaging Het
Rundc3a A G 11: 102,399,973 E294G possibly damaging Het
Scara3 T A 14: 65,931,416 I251L probably benign Het
Sirpb1c T C 3: 15,848,491 probably benign Het
Slc23a2 G A 2: 132,089,123 T152I probably damaging Het
Slc39a2 T G 14: 51,894,193 S74A possibly damaging Het
Tmprss15 T C 16: 78,962,019 Y937C probably damaging Het
Tpp2 T C 1: 43,978,778 L779S probably damaging Het
Tssk2 T C 16: 17,899,363 V210A possibly damaging Het
Ttn T A 2: 76,895,593 T6100S unknown Het
Tufm G A 7: 126,489,587 E317K possibly damaging Het
Wdfy4 A G 14: 33,047,314 S2219P Het
Wtap T C 17: 12,980,946 N50S possibly damaging Het
Other mutations in Prtg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00597:Prtg APN 9 72809644 missense probably damaging 1.00
IGL00942:Prtg APN 9 72892340 missense possibly damaging 0.82
IGL01821:Prtg APN 9 72911937 missense probably damaging 0.98
IGL01901:Prtg APN 9 72855066 missense probably damaging 1.00
IGL02143:Prtg APN 9 72892324 missense probably damaging 1.00
IGL02232:Prtg APN 9 72851489 missense probably damaging 1.00
IGL02451:Prtg APN 9 72856999 missense possibly damaging 0.95
IGL02510:Prtg APN 9 72890869 missense probably damaging 0.99
IGL02739:Prtg APN 9 72851585 missense possibly damaging 0.92
IGL03136:Prtg APN 9 72856985 missense possibly damaging 0.91
FR4548:Prtg UTSW 9 72857081 critical splice donor site probably benign
FR4589:Prtg UTSW 9 72856865 missense probably damaging 1.00
FR4737:Prtg UTSW 9 72857081 critical splice donor site probably benign
R0130:Prtg UTSW 9 72809716 missense probably damaging 1.00
R0321:Prtg UTSW 9 72848025 missense possibly damaging 0.83
R0390:Prtg UTSW 9 72844958 missense probably benign 0.24
R0900:Prtg UTSW 9 72844943 missense probably benign
R1121:Prtg UTSW 9 72906167 missense probably benign 0.15
R1438:Prtg UTSW 9 72910750 splice site probably benign
R1537:Prtg UTSW 9 72809757 missense probably benign 0.00
R1590:Prtg UTSW 9 72842807 missense probably benign
R1626:Prtg UTSW 9 72844911 missense probably damaging 1.00
R1965:Prtg UTSW 9 72848322 missense probably benign 0.27
R1993:Prtg UTSW 9 72844896 missense probably benign
R2351:Prtg UTSW 9 72856824 missense probably damaging 1.00
R3737:Prtg UTSW 9 72842709 nonsense probably null
R3921:Prtg UTSW 9 72848347 missense probably damaging 0.98
R4035:Prtg UTSW 9 72842709 nonsense probably null
R4378:Prtg UTSW 9 72842760 missense possibly damaging 0.91
R4687:Prtg UTSW 9 72890798 missense probably damaging 1.00
R5469:Prtg UTSW 9 72891965 missense probably damaging 0.98
R5556:Prtg UTSW 9 72851704 missense probably damaging 1.00
R5563:Prtg UTSW 9 72856898 missense probably damaging 1.00
R5710:Prtg UTSW 9 72809640 missense probably damaging 1.00
R5738:Prtg UTSW 9 72912006 missense probably benign 0.16
R5868:Prtg UTSW 9 72809717 nonsense probably null
R5961:Prtg UTSW 9 72856946 missense probably benign
R5964:Prtg UTSW 9 72892254 missense probably benign 0.41
R6217:Prtg UTSW 9 72904794 missense probably damaging 1.00
R6306:Prtg UTSW 9 72906186 missense probably benign 0.42
R6395:Prtg UTSW 9 72912132 missense possibly damaging 0.80
R6455:Prtg UTSW 9 72907856 missense probably damaging 1.00
R6673:Prtg UTSW 9 72851682 missense probably damaging 0.99
R6985:Prtg UTSW 9 72851501 missense probably damaging 1.00
R7014:Prtg UTSW 9 72891985 missense possibly damaging 0.95
R7233:Prtg UTSW 9 72911991 missense probably benign 0.00
R7261:Prtg UTSW 9 72907835 missense possibly damaging 0.94
R7372:Prtg UTSW 9 72851566 nonsense probably null
X0028:Prtg UTSW 9 72851716 missense possibly damaging 0.55
X0064:Prtg UTSW 9 72904892 splice site probably null
Predicted Primers PCR Primer
(F):5'- AGTCGGCAGGAAGAGCTTTG -3'
(R):5'- ACTGGCCCAGAAGCTTAAAGG -3'

Sequencing Primer
(F):5'- AAGAAGGGCTCATTGTTCTGAG -3'
(R):5'- GGATATAAAGAATTTGCCCCGC -3'
Posted On2019-09-13