Incidental Mutation 'R0639:Slitrk3'
ID56876
Institutional Source Beutler Lab
Gene Symbol Slitrk3
Ensembl Gene ENSMUSG00000048304
Gene NameSLIT and NTRK-like family, member 3
Synonyms
MMRRC Submission 038828-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.512) question?
Stock #R0639 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location73047265-73057803 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 73049649 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 597 (N597D)
Ref Sequence ENSEMBL: ENSMUSP00000141236 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059407] [ENSMUST00000192477]
Predicted Effect probably benign
Transcript: ENSMUST00000059407
AA Change: N597D

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000088561
Gene: ENSMUSG00000048304
AA Change: N597D

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Blast:LRRNT 44 79 3e-11 BLAST
LRR 101 124 2.08e1 SMART
LRR 125 148 6.05e0 SMART
LRR 149 172 3.97e0 SMART
LRR_TYP 173 196 1.67e-2 SMART
LRR 197 220 2.69e2 SMART
LRRCT 233 283 4.56e-5 SMART
low complexity region 332 350 N/A INTRINSIC
LRRNT 373 411 4.17e0 SMART
LRR 432 455 1.62e0 SMART
LRR_TYP 456 479 2.61e-4 SMART
LRR 480 503 2.82e0 SMART
LRR_TYP 504 527 6.99e-5 SMART
LRRCT 563 613 3.22e-5 SMART
transmembrane domain 658 680 N/A INTRINSIC
low complexity region 713 724 N/A INTRINSIC
low complexity region 836 843 N/A INTRINSIC
low complexity region 846 858 N/A INTRINSIC
low complexity region 870 888 N/A INTRINSIC
Blast:LRRCT 906 943 2e-16 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000192477
AA Change: N597D

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000141236
Gene: ENSMUSG00000048304
AA Change: N597D

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Blast:LRRNT 44 79 3e-11 BLAST
LRR 101 124 2.08e1 SMART
LRR 125 148 6.05e0 SMART
LRR 149 172 3.97e0 SMART
LRR_TYP 173 196 1.67e-2 SMART
LRR 197 220 2.69e2 SMART
LRRCT 233 283 4.56e-5 SMART
low complexity region 332 350 N/A INTRINSIC
LRRNT 373 411 4.17e0 SMART
LRR 432 455 1.62e0 SMART
LRR_TYP 456 479 2.61e-4 SMART
LRR 480 503 2.82e0 SMART
LRR_TYP 504 527 6.99e-5 SMART
LRRCT 563 613 3.22e-5 SMART
transmembrane domain 658 680 N/A INTRINSIC
low complexity region 713 724 N/A INTRINSIC
low complexity region 836 843 N/A INTRINSIC
low complexity region 846 858 N/A INTRINSIC
low complexity region 870 888 N/A INTRINSIC
Blast:LRRCT 906 943 2e-16 BLAST
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Slitrk family of structurally related transmembrane proteins that are involved in controlling neurite outgrowth. The encoded protein contains two leucine-rich repeat (LRR) domains and a C-terminal domain that is partially similar to Trk neurotrophin receptor protein. Enhanced expression of this gene was found in tissue from several different types of tumors. Alternative splicing results in multiple transcript variants, all encoding the same protein. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a knock-out mice exhibit reduced inhibitory synapse density, decreased miniature inhibitory postsynaptic current frequency and increased susceptibility to spontaneous and pharmacologically-induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600014C23Rik C T 17: 45,733,073 W86* probably null Het
5830411N06Rik A G 7: 140,247,959 N27D probably benign Het
Acadl T C 1: 66,857,408 H75R probably benign Het
Adamtsl1 T C 4: 86,277,143 F599S probably damaging Het
Adrb3 T C 8: 27,228,265 N52S probably damaging Het
Agbl3 T A 6: 34,799,705 L377Q probably damaging Het
Akap9 T C 5: 4,060,318 L3007P probably damaging Het
Amer3 T A 1: 34,587,821 Y380* probably null Het
Ankrd13d A T 19: 4,273,019 probably null Het
Ap4m1 T A 5: 138,176,239 C235S probably benign Het
Arhgap29 T C 3: 122,007,641 F675S probably damaging Het
Asah2 C A 19: 32,008,639 V544F probably damaging Het
Ash2l A G 8: 25,823,291 I389T possibly damaging Het
Bend5 T C 4: 111,433,298 S164P probably benign Het
Cacna1d A G 14: 30,171,294 probably null Het
Cdc25b A G 2: 131,197,262 N516D probably benign Het
Cdc27 A G 11: 104,531,734 Y125H probably damaging Het
Cdk5r2 C T 1: 74,855,836 L247F probably damaging Het
Cenpf C A 1: 189,658,062 G1191V probably benign Het
Cops4 C T 5: 100,537,460 T293I possibly damaging Het
Csmd3 A G 15: 47,913,940 L1294P probably damaging Het
Dclre1a T C 19: 56,538,440 Y848C probably damaging Het
Disp2 A T 2: 118,790,844 I686F possibly damaging Het
Dnah6 T A 6: 73,022,412 Y4012F probably benign Het
Dnajc11 C G 4: 151,969,936 R200G probably damaging Het
Dnhd1 A T 7: 105,696,464 D2272V possibly damaging Het
Elane A C 10: 79,886,349 R5S possibly damaging Het
Entpd7 G A 19: 43,691,094 V29M probably benign Het
Fanca A G 8: 123,289,359 probably null Het
Fgl1 G T 8: 41,191,624 T281K probably benign Het
Flii T C 11: 60,722,997 probably null Het
Foxn1 T C 11: 78,371,144 D133G possibly damaging Het
Fzd7 T A 1: 59,484,560 M534K probably damaging Het
Galnt5 A G 2: 57,999,395 T336A probably benign Het
Gli3 G A 13: 15,724,715 D896N probably damaging Het
Gsx1 G T 5: 147,189,946 W193L probably damaging Het
Gtpbp3 A T 8: 71,492,735 I485F probably damaging Het
H2-M11 A G 17: 36,547,391 T26A probably benign Het
Igfbp7 T C 5: 77,351,980 D243G probably damaging Het
Il31ra A T 13: 112,525,843 D477E possibly damaging Het
Inmt A C 6: 55,171,227 V139G probably damaging Het
Inpp5j T A 11: 3,501,147 M501L probably benign Het
Itsn2 T C 12: 4,712,556 F1579L probably damaging Het
Kat2b C A 17: 53,567,538 A70E probably benign Het
Klhl20 T C 1: 161,093,711 E58G probably damaging Het
Krt79 A T 15: 101,931,548 Y337* probably null Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Letm1 T C 5: 33,769,426 I176V possibly damaging Het
Lingo3 C A 10: 80,835,784 R104L probably benign Het
Lrig3 T G 10: 126,010,221 C840G probably damaging Het
Lrrc9 A G 12: 72,486,288 N977S probably damaging Het
Lrrk2 T A 15: 91,772,996 M1831K probably benign Het
Mn1 A T 5: 111,419,316 D384V probably damaging Het
Morc3 C A 16: 93,853,850 H319Q probably damaging Het
Morn1 T C 4: 155,089,503 F56L possibly damaging Het
Mrpl53 G T 6: 83,109,411 V64L probably damaging Het
Myo15 T A 11: 60,479,336 V974D probably benign Het
Neb A G 2: 52,256,124 V2947A possibly damaging Het
Nfasc A C 1: 132,603,816 N737K probably damaging Het
Nlk T C 11: 78,572,277 D464G possibly damaging Het
Nlrc4 C T 17: 74,426,963 R985K probably benign Het
Nsun6 T C 2: 14,996,336 K470E probably benign Het
Nup85 T G 11: 115,564,531 M1R probably null Het
Olfr887 G A 9: 38,085,370 C178Y probably damaging Het
Otop1 T C 5: 38,287,948 V150A possibly damaging Het
Pclo C T 5: 14,681,749 R296* probably null Het
Pdzd2 A T 15: 12,458,058 C240S possibly damaging Het
Plekhg5 A G 4: 152,114,120 T922A probably benign Het
Plekhm2 A C 4: 141,642,070 L101R probably damaging Het
Plscr3 T A 11: 69,847,994 C161S probably benign Het
Prr14l C T 5: 32,828,915 D1079N probably benign Het
Ptpru A T 4: 131,771,179 V1377E possibly damaging Het
Rab37 C A 11: 115,158,702 D112E probably benign Het
Raet1e T A 10: 22,174,375 I19N probably damaging Het
Rassf5 T C 1: 131,245,066 Y22C probably damaging Het
Rp1 T C 1: 4,346,498 T1464A probably benign Het
Safb T A 17: 56,601,092 probably benign Het
Scarf2 A G 16: 17,806,505 probably null Het
Sh3d19 T C 3: 86,106,973 S415P probably benign Het
Slc26a9 T A 1: 131,763,804 L595Q probably damaging Het
Slc4a8 T C 15: 100,796,550 Y470H probably damaging Het
Spata31 T A 13: 64,922,213 V725E probably benign Het
Spink12 T A 18: 44,107,764 C72* probably null Het
Spink5 T A 18: 44,012,975 probably null Het
Stk40 C A 4: 126,118,332 S9* probably null Het
Sypl A T 12: 32,965,421 T40S probably damaging Het
Tbc1d8 C T 1: 39,391,209 E438K probably benign Het
Tdrd7 A G 4: 45,989,102 T111A probably benign Het
Tg A T 15: 66,741,484 probably null Het
Tlr5 T A 1: 182,973,889 W253R probably damaging Het
Tmprss11c C T 5: 86,235,469 C353Y probably damaging Het
Tnfrsf8 T A 4: 145,288,027 M271L probably benign Het
Toe1 T C 4: 116,806,750 N21S probably benign Het
Tpp2 T C 1: 43,975,447 F649L probably benign Het
Ttll1 G A 15: 83,502,225 Q60* probably null Het
Vcp C T 4: 42,982,565 R709Q probably benign Het
Vmn1r119 T A 7: 21,011,668 H263L possibly damaging Het
Vmn1r195 C A 13: 22,278,941 Q194K probably damaging Het
Vmn1r33 T C 6: 66,611,799 Y257C probably damaging Het
Vmn2r15 A G 5: 109,293,015 F326L probably benign Het
Wbp11 A T 6: 136,816,110 probably benign Het
Wwp2 T G 8: 107,517,946 V250G probably benign Het
Xpnpep3 T C 15: 81,430,837 V246A probably benign Het
Zcchc14 G A 8: 121,605,449 R419* probably null Het
Other mutations in Slitrk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Slitrk3 APN 3 73051103 missense probably damaging 1.00
IGL00857:Slitrk3 APN 3 73049841 missense probably damaging 1.00
IGL00990:Slitrk3 APN 3 73050081 missense probably damaging 1.00
IGL01010:Slitrk3 APN 3 73049273 missense probably benign 0.14
IGL01299:Slitrk3 APN 3 73049016 missense probably benign 0.43
IGL01609:Slitrk3 APN 3 73050237 missense probably damaging 1.00
IGL01881:Slitrk3 APN 3 73049306 missense probably benign 0.00
IGL01941:Slitrk3 APN 3 73051071 missense possibly damaging 0.72
IGL02183:Slitrk3 APN 3 73049979 missense probably damaging 0.97
IGL02187:Slitrk3 APN 3 73050272 missense probably damaging 1.00
IGL02478:Slitrk3 APN 3 73050713 missense probably damaging 0.96
IGL02512:Slitrk3 APN 3 73050402 missense probably benign 0.28
IGL02720:Slitrk3 APN 3 73050768 missense probably damaging 1.00
IGL03113:Slitrk3 APN 3 73050390 missense probably benign 0.00
IGL03224:Slitrk3 APN 3 73049930 missense possibly damaging 0.72
wee UTSW 3 73050785 missense probably damaging 1.00
R0233:Slitrk3 UTSW 3 73048577 missense probably benign 0.00
R0233:Slitrk3 UTSW 3 73048577 missense probably benign 0.00
R1448:Slitrk3 UTSW 3 73050341 missense probably damaging 0.99
R1656:Slitrk3 UTSW 3 73050339 missense probably damaging 0.98
R1713:Slitrk3 UTSW 3 73049691 missense probably benign 0.00
R1992:Slitrk3 UTSW 3 73049771 missense possibly damaging 0.80
R1999:Slitrk3 UTSW 3 73049964 missense probably benign 0.13
R2359:Slitrk3 UTSW 3 73049345 missense possibly damaging 0.56
R3083:Slitrk3 UTSW 3 73048595 missense probably benign 0.00
R3153:Slitrk3 UTSW 3 73048982 nonsense probably null
R3821:Slitrk3 UTSW 3 73049216 missense possibly damaging 0.94
R4208:Slitrk3 UTSW 3 73051157 missense possibly damaging 0.67
R4323:Slitrk3 UTSW 3 73050785 missense probably damaging 1.00
R4580:Slitrk3 UTSW 3 73051206 missense probably damaging 0.96
R4730:Slitrk3 UTSW 3 73049519 missense probably benign 0.08
R4742:Slitrk3 UTSW 3 73048565 missense probably benign 0.00
R4979:Slitrk3 UTSW 3 73049796 missense possibly damaging 0.95
R5018:Slitrk3 UTSW 3 73050512 missense probably benign 0.31
R5023:Slitrk3 UTSW 3 73050648 missense probably benign 0.24
R5057:Slitrk3 UTSW 3 73050648 missense probably benign 0.24
R5156:Slitrk3 UTSW 3 73049259 missense probably benign
R5500:Slitrk3 UTSW 3 73050347 missense probably damaging 1.00
R5582:Slitrk3 UTSW 3 73050404 missense probably benign 0.09
R5797:Slitrk3 UTSW 3 73048629 missense probably damaging 0.99
R5963:Slitrk3 UTSW 3 73050713 missense probably benign 0.30
R5985:Slitrk3 UTSW 3 73050900 missense probably damaging 1.00
R6123:Slitrk3 UTSW 3 73049762 missense probably damaging 1.00
R6393:Slitrk3 UTSW 3 73049914 missense possibly damaging 0.79
R6529:Slitrk3 UTSW 3 73051218 missense probably benign 0.02
R6584:Slitrk3 UTSW 3 73049225 missense probably damaging 0.99
R6645:Slitrk3 UTSW 3 73049861 missense probably benign 0.13
R7001:Slitrk3 UTSW 3 73050609 nonsense probably null
R7282:Slitrk3 UTSW 3 73050465 missense possibly damaging 0.70
X0022:Slitrk3 UTSW 3 73050266 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAAAGGGCAACTTCTTCCTACGCCG -3'
(R):5'- AACTTGCTGAGGACTCTGCCAAC -3'

Sequencing Primer
(F):5'- GCCGACGGAGCACATAG -3'
(R):5'- TGAGGACTCTGCCAACTGATG -3'
Posted On2013-07-11