Incidental Mutation 'R7324:Cc2d2b'
ID568793
Institutional Source Beutler Lab
Gene Symbol Cc2d2b
Ensembl Gene ENSMUSG00000108929
Gene Namecoiled-coil and C2 domain containing 2B
SynonymsEG668310
Accession Numbers

NCBI RefSeq: XM_001000795; MGI: 3645359

Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R7324 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location40748753-40827743 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 40809108 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 778 (D778G)
Ref Sequence ENSEMBL: ENSMUSP00000146979 (fasta)
Predicted Effect unknown
Transcript: ENSMUST00000207801
AA Change: D778G
Predicted Effect probably damaging
Transcript: ENSMUST00000224596
AA Change: D1044G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg5 T C 17: 84,676,239 D124G possibly damaging Het
Ackr3 C G 1: 90,214,201 N127K probably damaging Het
AL732309.1 A C 2: 25,246,139 M21R possibly damaging Het
Ankrd52 C A 10: 128,386,163 T552K possibly damaging Het
Arid5b A T 10: 68,128,922 N306K probably benign Het
C1qtnf3 A C 15: 10,952,621 K56N probably benign Het
C2 C T 17: 34,881,688 G52D probably benign Het
Casz1 C T 4: 148,947,033 T1247M probably damaging Het
Cdh5 A G 8: 104,142,793 D717G probably damaging Het
Clca3a2 G A 3: 144,808,611 A445V probably damaging Het
Clca3b T A 3: 144,841,420 M319L possibly damaging Het
Csmd1 G A 8: 16,058,707 S1894L probably damaging Het
Csnk1g3 A G 18: 53,919,018 T220A probably damaging Het
Cyp2d10 T G 15: 82,403,760 T381P probably damaging Het
Ddb2 G A 2: 91,236,884 probably benign Het
Ddx24 C A 12: 103,416,259 L688F probably damaging Het
Dennd4c T C 4: 86,829,738 L1615P unknown Het
Dnah8 T A 17: 30,784,125 D3599E probably benign Het
Dst T C 1: 34,006,224 S13P possibly damaging Het
Efcab12 T C 6: 115,823,594 D156G probably benign Het
Enpp2 A G 15: 54,877,774 probably null Het
Ephx2 A G 14: 66,085,354 V490A probably damaging Het
Etnppl A G 3: 130,629,575 N308D probably damaging Het
F5 TCAGAAGACCTCCTCCCCAGACCTGGGCCAGGTGCCCCTTTCTCCAGATGACAACCAGAAGACCTCCTCCCCAGACCTGGGTCAGGTGTCCCTTTCTCCAGATGATAACCAGAAGACCTCCTCCCCAGACCTGGGTCAGGTGCCCCTTTCTCTAGATGACAACCAGAAGACGACCTCCCCAGACCTGGGTCAGGTGCCCCTTTCTCCAGATGACAACCAGA TCAGAAGACCTCCTCCCCAGACCTGGGTCAGGTGTCCCTTTCTCCAGATGATAACCAGAAGACCTCCTCCCCAGACCTGGGTCAGGTGCCCCTTTCTCTAGATGACAACCAGAAGACGACCTCCCCAGACCTGGGTCAGGTGCCCCTTTCTCCAGATGACAACCAGA 1: 164,193,581 probably benign Het
Fancl A G 11: 26,403,362 E86G probably damaging Het
Flii G A 11: 60,719,040 T615I probably benign Het
Fndc7 G T 3: 108,872,221 Q336K probably benign Het
Gm14025 T C 2: 129,037,852 D718G unknown Het
Gm26661 T C 14: 7,791,911 C109R unknown Het
H2-DMb1 T C 17: 34,159,462 probably null Het
H2-T10 C T 17: 36,119,297 G251R probably damaging Het
Harbi1 T C 2: 91,720,699 I339T probably benign Het
Hsp90aa1 A G 12: 110,695,225 M119T unknown Het
Ighe T A 12: 113,272,334 Y124F Het
Ighv7-1 T C 12: 113,896,529 Y81C probably damaging Het
Inpp5a A G 7: 139,525,670 D179G probably damaging Het
Itgad A T 7: 128,189,807 D510V probably damaging Het
Kcnn2 A T 18: 45,560,071 H238L probably benign Het
Kctd17 T A 15: 78,435,642 C189S probably damaging Het
Larp4b C A 13: 9,158,580 A423E probably benign Het
Llgl2 A G 11: 115,850,730 E562G possibly damaging Het
Macf1 T C 4: 123,374,425 T6734A probably benign Het
Maz G A 7: 127,024,593 T377M probably damaging Het
Mmrn1 G T 6: 60,944,933 G125* probably null Het
Mvp A G 7: 126,993,609 S377P probably benign Het
Nin C T 12: 70,043,734 R969Q Het
Nktr C T 9: 121,727,361 T35I probably damaging Het
Nktr T A 9: 121,748,291 M475K possibly damaging Het
Nod2 T A 8: 88,653,066 V65D probably damaging Het
Olfr1249 A T 2: 89,630,103 I265N possibly damaging Het
Olfr135 T C 17: 38,208,716 V157A probably benign Het
Olfr1487 A G 19: 13,619,578 I96V probably benign Het
Olfr1493-ps1 C T 19: 13,726,906 A215V probably benign Het
Olfr203 T C 16: 59,303,248 F32L probably benign Het
Olfr398 A G 11: 73,983,843 V255A probably benign Het
Olfr794 T A 10: 129,570,849 S65T probably damaging Het
Olfr868 A T 9: 20,101,430 I224F possibly damaging Het
Opa1 A T 16: 29,586,981 E121D probably benign Het
Osbpl2 A G 2: 180,150,201 T233A probably benign Het
Pcp4l1 G A 1: 171,174,465 A42V possibly damaging Het
Plekhh3 T A 11: 101,170,774 D38V possibly damaging Het
Prtg C T 9: 72,890,840 A696V probably damaging Het
Ptpn14 T G 1: 189,863,424 V748G possibly damaging Het
Reg2 A T 6: 78,406,154 D28V probably benign Het
Rhpn1 A T 15: 75,704,397 I2F possibly damaging Het
Rundc3a A G 11: 102,399,973 E294G possibly damaging Het
Scara3 T A 14: 65,931,416 I251L probably benign Het
Sirpb1c T C 3: 15,848,491 probably benign Het
Slc23a2 G A 2: 132,089,123 T152I probably damaging Het
Slc39a2 T G 14: 51,894,193 S74A possibly damaging Het
Tmprss15 T C 16: 78,962,019 Y937C probably damaging Het
Tpp2 T C 1: 43,978,778 L779S probably damaging Het
Tssk2 T C 16: 17,899,363 V210A possibly damaging Het
Ttn T A 2: 76,895,593 T6100S unknown Het
Tufm G A 7: 126,489,587 E317K possibly damaging Het
Wdfy4 A G 14: 33,047,314 S2219P Het
Wtap T C 17: 12,980,946 N50S possibly damaging Het
Other mutations in Cc2d2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
1mM(1):Cc2d2b UTSW 19 40795685 missense possibly damaging 0.60
R6163:Cc2d2b UTSW 19 40756506 missense probably benign 0.31
R6481:Cc2d2b UTSW 19 40802395 missense possibly damaging 0.95
R6651:Cc2d2b UTSW 19 40778129 missense probably damaging 0.97
R6747:Cc2d2b UTSW 19 40795667 missense probably benign 0.03
R6799:Cc2d2b UTSW 19 40791208 missense possibly damaging 0.69
R6857:Cc2d2b UTSW 19 40770865 missense possibly damaging 0.62
R6869:Cc2d2b UTSW 19 40809454 missense probably benign 0.06
R6881:Cc2d2b UTSW 19 40825039 missense probably damaging 0.99
R6900:Cc2d2b UTSW 19 40825074 missense probably null 0.08
R6902:Cc2d2b UTSW 19 40816289 missense possibly damaging 0.93
R6960:Cc2d2b UTSW 19 40785062 missense possibly damaging 0.85
R7016:Cc2d2b UTSW 19 40795804 missense possibly damaging 0.85
R7039:Cc2d2b UTSW 19 40802401 missense probably damaging 1.00
R7072:Cc2d2b UTSW 19 40760359 missense unknown
R7192:Cc2d2b UTSW 19 40774437 missense unknown
R7226:Cc2d2b UTSW 19 40791307 missense unknown
R7303:Cc2d2b UTSW 19 40808994 missense unknown
Predicted Primers PCR Primer
(F):5'- GGACATTTCAAGTGAACATCCC -3'
(R):5'- AACATGGCCTTACAGTTCCTGG -3'

Sequencing Primer
(F):5'- AGTGAACATCCCACCCATTTTG -3'
(R):5'- GGCCTTACAGTTCCTGGTAAAAGTC -3'
Posted On2019-09-13