Incidental Mutation 'R7326:Frem2'
ID568871
Institutional Source Beutler Lab
Gene Symbol Frem2
Ensembl Gene ENSMUSG00000037016
Gene NameFras1 related extracellular matrix protein 2
Synonymsmy, ne, 6030440P17Rik, b2b1562Clo, 8430406N05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7326 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location53513938-53657355 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 53654753 bp
ZygosityHeterozygous
Amino Acid Change Proline to Alanine at position 778 (P778A)
Ref Sequence ENSEMBL: ENSMUSP00000088670 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091137]
Predicted Effect probably damaging
Transcript: ENSMUST00000091137
AA Change: P778A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088670
Gene: ENSMUSG00000037016
AA Change: P778A

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
Pfam:Cadherin_3 249 388 4.3e-9 PFAM
Pfam:Cadherin_3 376 532 3e-34 PFAM
Pfam:Cadherin_3 516 665 7.5e-24 PFAM
Pfam:Cadherin_3 632 798 1.6e-21 PFAM
Pfam:Cadherin_3 763 910 1.2e-25 PFAM
Pfam:Cadherin_3 879 1027 5.1e-18 PFAM
Pfam:Cadherin_3 1015 1159 2.2e-20 PFAM
CA 1202 1293 4.8e-1 SMART
Pfam:Cadherin_3 1392 1503 9.8e-24 PFAM
Pfam:Cadherin_3 1504 1612 6.2e-28 PFAM
Pfam:Cadherin_3 1613 1743 5.3e-20 PFAM
Calx_beta 1748 1847 1.5e-5 SMART
Calx_beta 1860 1971 9.47e-12 SMART
Calx_beta 1985 2092 1.65e-11 SMART
Calx_beta 2105 2209 1.99e-5 SMART
Calx_beta 2227 2331 6.9e-14 SMART
transmembrane domain 3103 3125 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein containing numerous CSPG (chondroitin sulfate proteoglycan element) repeats and Calx-beta domains. The encoded protein localizes to the basement membrane, forming a ternary complex that plays a role in epidermal-dermal interactions. This protein is important for the integrity of skin and renal epithelia. Mutations in this gene are associated with Fraser syndrome. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for mutations at this locus display a significant amount of embryonic lethality due to hemorrhaging of embryonic blisters. Kidney development is severely affected and syndactyly is common. Phenotypes of homozygous mutants are indistinguishable from those of Fras1 homozygous mutant. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430531B16Rik A T 7: 139,978,545 probably null Het
Abcb4 T C 5: 8,934,226 V652A probably benign Het
Acvrl1 G T 15: 101,141,072 V417L probably damaging Het
Add1 A G 5: 34,619,371 R479G probably benign Het
Adgb A T 10: 10,400,574 L350Q possibly damaging Het
Adgrl2 A T 3: 148,846,870 S666T probably benign Het
Akap9 T A 5: 4,045,930 D2268E possibly damaging Het
Amigo3 C A 9: 108,054,066 H229Q probably benign Het
Ano6 G C 15: 95,864,244 Q31H possibly damaging Het
Ap4m1 G A 5: 138,175,019 D180N probably damaging Het
Apc2 A T 10: 80,311,740 D876V probably damaging Het
Apcdd1 T A 18: 62,952,188 Y485* probably null Het
Aqp1 G T 6: 55,336,851 D121Y probably benign Het
Bicd2 C A 13: 49,369,609 R141S probably benign Het
Brpf3 C A 17: 28,806,293 H113Q probably benign Het
Cacng2 A T 15: 78,013,320 Y96* probably null Het
Catsperg1 G T 7: 29,210,759 N52K possibly damaging Het
Celsr2 A C 3: 108,394,995 F2606V possibly damaging Het
Cerkl A T 2: 79,332,605 N516K probably benign Het
Ciita G A 16: 10,512,288 R812H probably damaging Het
Cldn3 T A 5: 134,986,983 L180Q probably damaging Het
Cnot6l T C 5: 96,077,299 I512V probably benign Het
Col5a2 A T 1: 45,442,867 D32E unknown Het
Coro7 A G 16: 4,632,048 V616A probably damaging Het
Cyp4f18 T C 8: 71,988,654 D494G probably benign Het
Ddx39 T A 8: 83,722,471 V296E probably benign Het
Dgkg A T 16: 22,548,690 H593Q probably damaging Het
Dhx16 T C 17: 35,886,160 L645P probably damaging Het
Dnah14 A G 1: 181,598,403 M171V probably benign Het
Dnhd1 G A 7: 105,720,930 V4521I probably damaging Het
Dok7 A T 5: 35,064,522 M60L probably benign Het
Donson A T 16: 91,688,711 M1K probably null Het
Dsp C T 13: 38,192,883 T1548M probably benign Het
Dyrk1a A G 16: 94,692,043 T712A probably damaging Het
Eef2 A G 10: 81,181,282 T708A probably benign Het
Epn3 G A 11: 94,493,780 T289I probably benign Het
Fam171a1 C T 2: 3,226,472 R881* probably null Het
Fam71a G A 1: 191,164,353 T31M probably benign Het
Fat2 T A 11: 55,282,304 R2528W probably damaging Het
Fgfr1 T G 8: 25,573,839 F707C probably damaging Het
Ganc A G 2: 120,430,599 Y255C probably damaging Het
Ginm1 A T 10: 7,777,850 Y65* probably null Het
Gm11559 T A 11: 99,864,881 C119S unknown Het
Gnai1 T A 5: 18,289,551 H188L Het
H6pd C T 4: 149,996,350 A13T probably benign Het
Hist1h2be T C 13: 23,585,923 K12E probably benign Het
Hoxd12 A T 2: 74,675,246 T54S possibly damaging Het
Hs3st5 T A 10: 36,833,194 L242M probably damaging Het
Il9r C A 11: 32,194,389 V139L possibly damaging Het
Immt A G 6: 71,846,369 D68G probably damaging Het
Itsn2 A G 12: 4,632,985 I304V unknown Het
Lgr4 G A 2: 109,996,629 W159* probably null Het
Lin52 G A 12: 84,457,954 G38S probably damaging Het
Lpgat1 A T 1: 191,719,453 M64L probably benign Het
Lrrc10b G T 19: 10,456,778 R180S possibly damaging Het
Lrrc29 T C 8: 105,312,898 D127G probably damaging Het
Lrrc36 A T 8: 105,449,769 L258F possibly damaging Het
Ltbp4 T A 7: 27,329,755 Q235L unknown Het
Maml2 A G 9: 13,621,607 M706V Het
Mc5r G T 18: 68,339,668 C366F probably damaging Het
Mlip T C 9: 77,164,842 R244G probably benign Het
Muc16 T A 9: 18,585,013 R6658S probably benign Het
Mup4 G T 4: 59,960,046 H73N possibly damaging Het
Nf1 A G 11: 79,564,943 M565V probably benign Het
Nphp1 G A 2: 127,761,217 T382I possibly damaging Het
Nrcam C T 12: 44,564,026 T503I possibly damaging Het
Nwd2 A T 5: 63,800,409 N361Y probably damaging Het
Olfr1045 A G 2: 86,198,573 Y60H probably damaging Het
Olfr1309 A T 2: 111,983,327 L249* probably null Het
Olfr308 A G 7: 86,321,574 I126T probably damaging Het
Olfr461 G T 6: 40,544,895 A28E probably damaging Het
Olfr518 A T 7: 108,880,816 H263Q probably damaging Het
Olfr836 A G 9: 19,121,669 Y235C probably benign Het
Olfr993 A T 2: 85,414,444 V145E probably damaging Het
Orc5 A G 5: 22,523,584 F308L probably benign Het
Padi1 T A 4: 140,832,404 Y54F probably benign Het
Parp1 A G 1: 180,569,100 K23E possibly damaging Het
Pate1 A T 9: 35,685,972 V79D possibly damaging Het
Pcdh18 T C 3: 49,756,860 H2R probably benign Het
Pcnx2 G A 8: 125,887,083 S543F probably damaging Het
Pcp4l1 G A 1: 171,174,465 A42V possibly damaging Het
Pnkp T A 7: 44,859,734 F169L probably damaging Het
Ppp6r3 A T 19: 3,507,325 N254K probably damaging Het
Psd A G 19: 46,324,454 L159P probably benign Het
Ptprf A G 4: 118,231,669 Y646H probably damaging Het
Rab3ip A T 10: 116,937,633 S92T probably benign Het
Rabgef1 A G 5: 130,187,351 probably benign Het
Ralgapa1 C A 12: 55,709,004 W1129L probably damaging Het
Rhpn2 T A 7: 35,385,463 L594Q probably benign Het
Rnf38 C A 4: 44,158,989 probably benign Het
Ryr2 T A 13: 11,738,194 H1747L possibly damaging Het
Sec16a A G 2: 26,439,717 L13P unknown Het
Sppl3 C A 5: 115,082,335 T102K probably damaging Het
Srgap2 A T 1: 131,291,613 Y264* probably null Het
Stxbp2 T C 8: 3,641,151 M465T Het
Sumf2 A G 5: 129,862,710 K305R probably benign Het
Susd2 T A 10: 75,642,565 Y59F probably benign Het
Taco1 T C 11: 106,072,617 V198A probably benign Het
Tas2r136 A T 6: 132,777,906 M86K possibly damaging Het
Tbc1d10c T C 19: 4,184,898 E388G possibly damaging Het
Tmem132c C T 5: 127,564,059 T1098I possibly damaging Het
Trim3 G T 7: 105,617,800 Y457* probably null Het
Ttc38 A G 15: 85,852,861 T316A probably benign Het
Ubqln4 T A 3: 88,555,910 N127K probably benign Het
Wdr91 A T 6: 34,904,626 F262Y probably damaging Het
Zdhhc6 A T 19: 55,302,755 C343S possibly damaging Het
Zfp248 A G 6: 118,430,209 C140R probably damaging Het
Zfp266 T C 9: 20,502,095 T90A probably benign Het
Zfp407 A T 18: 84,559,042 D1315E possibly damaging Het
Zfp644 T C 5: 106,638,277 S135G probably benign Het
Zscan29 A T 2: 121,160,988 I773N probably damaging Het
Zswim5 T A 4: 116,980,834 V787E possibly damaging Het
Other mutations in Frem2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00895:Frem2 APN 3 53585595 missense probably damaging 1.00
IGL00911:Frem2 APN 3 53572462 missense probably damaging 1.00
IGL01322:Frem2 APN 3 53541038 missense probably benign 0.00
IGL01330:Frem2 APN 3 53655241 missense possibly damaging 0.70
IGL01406:Frem2 APN 3 53525896 missense probably damaging 1.00
IGL01556:Frem2 APN 3 53535281 missense probably benign 0.23
IGL01580:Frem2 APN 3 53655175 missense probably damaging 1.00
IGL01606:Frem2 APN 3 53653591 missense possibly damaging 0.69
IGL01611:Frem2 APN 3 53655709 missense probably benign 0.00
IGL01648:Frem2 APN 3 53535732 missense possibly damaging 0.86
IGL01663:Frem2 APN 3 53517013 missense probably damaging 1.00
IGL01665:Frem2 APN 3 53549662 missense probably benign 0.07
IGL01670:Frem2 APN 3 53656937 missense possibly damaging 0.95
IGL01960:Frem2 APN 3 53522304 missense probably benign 0.33
IGL02175:Frem2 APN 3 53655599 missense possibly damaging 0.69
IGL02201:Frem2 APN 3 53519640 missense probably benign 0.35
IGL02202:Frem2 APN 3 53654799 missense probably benign 0.00
IGL02427:Frem2 APN 3 53535763 missense probably damaging 0.97
IGL02457:Frem2 APN 3 53521049 missense probably damaging 0.99
IGL02638:Frem2 APN 3 53551346 missense possibly damaging 0.94
IGL02801:Frem2 APN 3 53652175 missense possibly damaging 0.85
IGL03023:Frem2 APN 3 53655628 missense probably benign 0.40
IGL03169:Frem2 APN 3 53522292 missense probably benign 0.01
IGL03238:Frem2 APN 3 53656261 missense possibly damaging 0.93
IGL03251:Frem2 APN 3 53572308 missense probably benign 0.01
IGL03273:Frem2 APN 3 53537509 nonsense probably null
IGL03343:Frem2 APN 3 53652253 missense probably damaging 1.00
Biosimilar UTSW 3 53654323 missense probably benign 0.01
Fruit_stripe UTSW 3 53537489 missense probably benign 0.21
PIT4366001:Frem2 UTSW 3 53653201 missense probably damaging 0.98
R0019:Frem2 UTSW 3 53523678 missense probably damaging 0.99
R0092:Frem2 UTSW 3 53589796 missense probably benign 0.03
R0108:Frem2 UTSW 3 53647961 missense probably benign 0.03
R0115:Frem2 UTSW 3 53656208 missense probably damaging 0.99
R0118:Frem2 UTSW 3 53535243 nonsense probably null
R0374:Frem2 UTSW 3 53653960 missense probably damaging 1.00
R0437:Frem2 UTSW 3 53653015 missense possibly damaging 0.96
R0531:Frem2 UTSW 3 53519954 missense probably damaging 1.00
R0555:Frem2 UTSW 3 53516860 missense probably damaging 0.97
R0564:Frem2 UTSW 3 53656109 missense probably damaging 0.97
R0586:Frem2 UTSW 3 53647921 missense probably damaging 0.99
R0726:Frem2 UTSW 3 53519626 missense possibly damaging 0.89
R0925:Frem2 UTSW 3 53653973 missense probably benign
R1233:Frem2 UTSW 3 53547778 missense probably damaging 0.98
R1302:Frem2 UTSW 3 53655538 missense probably benign 0.00
R1333:Frem2 UTSW 3 53549731 missense probably benign 0.26
R1446:Frem2 UTSW 3 53654596 missense probably benign 0.31
R1523:Frem2 UTSW 3 53655407 missense possibly damaging 0.73
R1539:Frem2 UTSW 3 53654210 missense probably benign 0.19
R1543:Frem2 UTSW 3 53572455 missense possibly damaging 0.86
R1597:Frem2 UTSW 3 53654519 missense probably benign 0.19
R1600:Frem2 UTSW 3 53547723 missense probably damaging 1.00
R1678:Frem2 UTSW 3 53519938 missense probably damaging 1.00
R1687:Frem2 UTSW 3 53653952 missense probably benign
R1696:Frem2 UTSW 3 53656042 nonsense probably null
R1758:Frem2 UTSW 3 53653357 missense probably damaging 1.00
R1857:Frem2 UTSW 3 53654873 missense probably benign 0.10
R1869:Frem2 UTSW 3 53535196 missense probably benign 0.04
R1921:Frem2 UTSW 3 53653495 missense possibly damaging 0.76
R1973:Frem2 UTSW 3 53652232 missense probably benign 0.01
R2045:Frem2 UTSW 3 53535744 missense probably damaging 1.00
R2113:Frem2 UTSW 3 53652922 missense probably damaging 1.00
R2152:Frem2 UTSW 3 53517029 nonsense probably null
R2164:Frem2 UTSW 3 53537330 missense probably damaging 1.00
R2181:Frem2 UTSW 3 53574587 missense possibly damaging 0.72
R2201:Frem2 UTSW 3 53516573 missense probably benign
R2221:Frem2 UTSW 3 53516857 missense probably benign 0.00
R2255:Frem2 UTSW 3 53652514 missense probably damaging 0.96
R2280:Frem2 UTSW 3 53572423 missense probably damaging 1.00
R3196:Frem2 UTSW 3 53537331 missense probably damaging 1.00
R3716:Frem2 UTSW 3 53572360 missense probably damaging 1.00
R3807:Frem2 UTSW 3 53653449 missense probably benign 0.22
R3820:Frem2 UTSW 3 53516849 missense probably damaging 1.00
R3821:Frem2 UTSW 3 53652415 missense probably damaging 1.00
R3977:Frem2 UTSW 3 53652070 missense probably benign 0.00
R3979:Frem2 UTSW 3 53652070 missense probably benign 0.00
R4014:Frem2 UTSW 3 53652353 missense probably benign 0.01
R4127:Frem2 UTSW 3 53525896 missense probably damaging 1.00
R4195:Frem2 UTSW 3 53539268 missense possibly damaging 0.90
R4196:Frem2 UTSW 3 53539268 missense possibly damaging 0.90
R4374:Frem2 UTSW 3 53545502 missense possibly damaging 0.61
R4427:Frem2 UTSW 3 53539162 critical splice donor site probably null
R4428:Frem2 UTSW 3 53654338 missense probably benign 0.40
R4559:Frem2 UTSW 3 53654321 missense probably benign 0.01
R4600:Frem2 UTSW 3 53547807 missense possibly damaging 0.96
R4602:Frem2 UTSW 3 53547807 missense possibly damaging 0.96
R4610:Frem2 UTSW 3 53547807 missense possibly damaging 0.96
R4611:Frem2 UTSW 3 53547807 missense possibly damaging 0.96
R4661:Frem2 UTSW 3 53655443 missense probably damaging 1.00
R4678:Frem2 UTSW 3 53544371 missense probably benign 0.00
R4689:Frem2 UTSW 3 53547635 missense probably benign 0.43
R4740:Frem2 UTSW 3 53535819 missense probably benign 0.04
R4748:Frem2 UTSW 3 53541093 missense probably damaging 1.00
R4790:Frem2 UTSW 3 53516741 missense probably benign
R4809:Frem2 UTSW 3 53653895 missense probably benign 0.01
R4930:Frem2 UTSW 3 53656315 missense possibly damaging 0.93
R4971:Frem2 UTSW 3 53539183 missense probably damaging 1.00
R5057:Frem2 UTSW 3 53535196 missense probably benign 0.37
R5202:Frem2 UTSW 3 53551346 missense probably benign 0.41
R5221:Frem2 UTSW 3 53585611 missense probably damaging 1.00
R5231:Frem2 UTSW 3 53522295 missense probably damaging 1.00
R5268:Frem2 UTSW 3 53653154 missense probably damaging 0.96
R5480:Frem2 UTSW 3 53656507 nonsense probably null
R5637:Frem2 UTSW 3 53652937 missense probably damaging 0.97
R5664:Frem2 UTSW 3 53652490 missense probably benign 0.33
R5698:Frem2 UTSW 3 53652505 missense possibly damaging 0.89
R5744:Frem2 UTSW 3 53655959 missense probably damaging 1.00
R5754:Frem2 UTSW 3 53537258 missense probably damaging 1.00
R5808:Frem2 UTSW 3 53652563 missense probably damaging 0.96
R5840:Frem2 UTSW 3 53647921 missense probably damaging 0.99
R5874:Frem2 UTSW 3 53537489 missense probably benign 0.21
R6050:Frem2 UTSW 3 53653012 missense probably damaging 0.99
R6103:Frem2 UTSW 3 53549788 missense probably benign 0.00
R6149:Frem2 UTSW 3 53551341 missense probably damaging 0.98
R6182:Frem2 UTSW 3 53647969 missense probably damaging 1.00
R6191:Frem2 UTSW 3 53655280 missense probably benign 0.10
R6245:Frem2 UTSW 3 53655824 missense probably benign 0.00
R6252:Frem2 UTSW 3 53572448 missense probably damaging 1.00
R6393:Frem2 UTSW 3 53585640 missense possibly damaging 0.91
R6416:Frem2 UTSW 3 53572378 missense probably benign 0.01
R6595:Frem2 UTSW 3 53549784 missense probably damaging 1.00
R6665:Frem2 UTSW 3 53654656 missense probably damaging 1.00
R6708:Frem2 UTSW 3 53585501 missense probably benign 0.00
R6751:Frem2 UTSW 3 53653665 missense probably damaging 1.00
R6787:Frem2 UTSW 3 53654323 missense probably benign 0.01
R6913:Frem2 UTSW 3 53516821 missense probably damaging 1.00
R6916:Frem2 UTSW 3 53547688 missense probably damaging 1.00
R7017:Frem2 UTSW 3 53519602 missense probably benign 0.02
R7083:Frem2 UTSW 3 53537493 missense probably damaging 0.99
R7108:Frem2 UTSW 3 53653513 missense probably damaging 1.00
R7133:Frem2 UTSW 3 53572339 missense possibly damaging 0.82
R7341:Frem2 UTSW 3 53654495 missense probably damaging 1.00
R7487:Frem2 UTSW 3 53654549 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- CATCACTCACATGCAGCTCG -3'
(R):5'- AAGGTGGCTGCACTACACTG -3'

Sequencing Primer
(F):5'- ACATGCAGCTCGGTCTCAC -3'
(R):5'- TGGCTGCACTACACTGACCTG -3'
Posted On2019-09-13