Incidental Mutation 'R0639:Plekhg5'
ID56893
Institutional Source Beutler Lab
Gene Symbol Plekhg5
Ensembl Gene ENSMUSG00000039713
Gene Namepleckstrin homology domain containing, family G (with RhoGef domain) member 5
Synonyms
MMRRC Submission 038828-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.150) question?
Stock #R0639 (G1)
Quality Score223
Status Not validated
Chromosome4
Chromosomal Location152072498-152115400 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 152114120 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 922 (T922A)
Ref Sequence ENSEMBL: ENSMUSP00000101286 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025706] [ENSMUST00000035275] [ENSMUST00000084115] [ENSMUST00000105661] [ENSMUST00000105662] [ENSMUST00000118648]
Predicted Effect probably benign
Transcript: ENSMUST00000025706
SMART Domains Protein: ENSMUSP00000025706
Gene: ENSMUSG00000024793

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
TNFR 38 75 4.12e0 SMART
TNFR 78 120 3.78e-5 SMART
transmembrane domain 196 218 N/A INTRINSIC
DEATH 315 407 6.04e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000035275
SMART Domains Protein: ENSMUSP00000047823
Gene: ENSMUSG00000024793

DomainStartEndE-ValueType
signal peptide 1 43 N/A INTRINSIC
TNFR 51 88 4.12e0 SMART
TNFR 91 133 3.78e-5 SMART
transmembrane domain 172 194 N/A INTRINSIC
DEATH 291 383 6.04e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000084115
AA Change: T922A

PolyPhen 2 Score 0.190 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000081132
Gene: ENSMUSG00000039713
AA Change: T922A

DomainStartEndE-ValueType
low complexity region 314 334 N/A INTRINSIC
low complexity region 369 380 N/A INTRINSIC
RhoGEF 410 597 5.21e-53 SMART
PH 655 756 7.35e-12 SMART
low complexity region 778 790 N/A INTRINSIC
low complexity region 895 934 N/A INTRINSIC
low complexity region 1060 1069 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105661
AA Change: T922A

PolyPhen 2 Score 0.190 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000101286
Gene: ENSMUSG00000039713
AA Change: T922A

DomainStartEndE-ValueType
low complexity region 314 334 N/A INTRINSIC
low complexity region 369 380 N/A INTRINSIC
RhoGEF 410 597 5.21e-53 SMART
PH 655 756 7.35e-12 SMART
low complexity region 778 790 N/A INTRINSIC
low complexity region 895 934 N/A INTRINSIC
low complexity region 1060 1069 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105662
AA Change: T890A

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000101287
Gene: ENSMUSG00000039713
AA Change: T890A

DomainStartEndE-ValueType
low complexity region 282 302 N/A INTRINSIC
low complexity region 337 348 N/A INTRINSIC
RhoGEF 378 565 5.21e-53 SMART
PH 623 724 7.35e-12 SMART
low complexity region 746 758 N/A INTRINSIC
low complexity region 863 902 N/A INTRINSIC
low complexity region 1028 1037 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118648
AA Change: T909A

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000112707
Gene: ENSMUSG00000039713
AA Change: T909A

DomainStartEndE-ValueType
low complexity region 301 321 N/A INTRINSIC
low complexity region 356 367 N/A INTRINSIC
RhoGEF 397 584 5.21e-53 SMART
PH 642 743 7.35e-12 SMART
low complexity region 765 777 N/A INTRINSIC
low complexity region 882 921 N/A INTRINSIC
low complexity region 1047 1056 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127111
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140085
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153619
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein belonging to the Rho guanine exchange factor (GEF) family of proteins, which activate GTPases by replacing GDP with GTP. This family member is a RhoA GEF that plays a role in endothelial cell migration and tube formation. It is required for angiogenesis and may function in neuronal cell differentiation. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Oct 2013]
PHENOTYPE: Mice homozygous for a knock-out allele display angiogenic defects that affect multiple organs, including sparser coronary and kidney arterial systems that appear to deficient in small diameter vessels while the major coronary and kidney arteries remain intact. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600014C23Rik C T 17: 45,733,073 W86* probably null Het
5830411N06Rik A G 7: 140,247,959 N27D probably benign Het
Acadl T C 1: 66,857,408 H75R probably benign Het
Adamtsl1 T C 4: 86,277,143 F599S probably damaging Het
Adrb3 T C 8: 27,228,265 N52S probably damaging Het
Agbl3 T A 6: 34,799,705 L377Q probably damaging Het
Akap9 T C 5: 4,060,318 L3007P probably damaging Het
Amer3 T A 1: 34,587,821 Y380* probably null Het
Ankrd13d A T 19: 4,273,019 probably null Het
Ap4m1 T A 5: 138,176,239 C235S probably benign Het
Arhgap29 T C 3: 122,007,641 F675S probably damaging Het
Asah2 C A 19: 32,008,639 V544F probably damaging Het
Ash2l A G 8: 25,823,291 I389T possibly damaging Het
Bend5 T C 4: 111,433,298 S164P probably benign Het
Cacna1d A G 14: 30,171,294 probably null Het
Cdc25b A G 2: 131,197,262 N516D probably benign Het
Cdc27 A G 11: 104,531,734 Y125H probably damaging Het
Cdk5r2 C T 1: 74,855,836 L247F probably damaging Het
Cenpf C A 1: 189,658,062 G1191V probably benign Het
Cops4 C T 5: 100,537,460 T293I possibly damaging Het
Csmd3 A G 15: 47,913,940 L1294P probably damaging Het
Dclre1a T C 19: 56,538,440 Y848C probably damaging Het
Disp2 A T 2: 118,790,844 I686F possibly damaging Het
Dnah6 T A 6: 73,022,412 Y4012F probably benign Het
Dnajc11 C G 4: 151,969,936 R200G probably damaging Het
Dnhd1 A T 7: 105,696,464 D2272V possibly damaging Het
Elane A C 10: 79,886,349 R5S possibly damaging Het
Entpd7 G A 19: 43,691,094 V29M probably benign Het
Fanca A G 8: 123,289,359 probably null Het
Fgl1 G T 8: 41,191,624 T281K probably benign Het
Flii T C 11: 60,722,997 probably null Het
Foxn1 T C 11: 78,371,144 D133G possibly damaging Het
Fzd7 T A 1: 59,484,560 M534K probably damaging Het
Galnt5 A G 2: 57,999,395 T336A probably benign Het
Gli3 G A 13: 15,724,715 D896N probably damaging Het
Gsx1 G T 5: 147,189,946 W193L probably damaging Het
Gtpbp3 A T 8: 71,492,735 I485F probably damaging Het
H2-M11 A G 17: 36,547,391 T26A probably benign Het
Igfbp7 T C 5: 77,351,980 D243G probably damaging Het
Il31ra A T 13: 112,525,843 D477E possibly damaging Het
Inmt A C 6: 55,171,227 V139G probably damaging Het
Inpp5j T A 11: 3,501,147 M501L probably benign Het
Itsn2 T C 12: 4,712,556 F1579L probably damaging Het
Kat2b C A 17: 53,567,538 A70E probably benign Het
Klhl20 T C 1: 161,093,711 E58G probably damaging Het
Krt79 A T 15: 101,931,548 Y337* probably null Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Letm1 T C 5: 33,769,426 I176V possibly damaging Het
Lingo3 C A 10: 80,835,784 R104L probably benign Het
Lrig3 T G 10: 126,010,221 C840G probably damaging Het
Lrrc9 A G 12: 72,486,288 N977S probably damaging Het
Lrrk2 T A 15: 91,772,996 M1831K probably benign Het
Mn1 A T 5: 111,419,316 D384V probably damaging Het
Morc3 C A 16: 93,853,850 H319Q probably damaging Het
Morn1 T C 4: 155,089,503 F56L possibly damaging Het
Mrpl53 G T 6: 83,109,411 V64L probably damaging Het
Myo15 T A 11: 60,479,336 V974D probably benign Het
Neb A G 2: 52,256,124 V2947A possibly damaging Het
Nfasc A C 1: 132,603,816 N737K probably damaging Het
Nlk T C 11: 78,572,277 D464G possibly damaging Het
Nlrc4 C T 17: 74,426,963 R985K probably benign Het
Nsun6 T C 2: 14,996,336 K470E probably benign Het
Nup85 T G 11: 115,564,531 M1R probably null Het
Olfr887 G A 9: 38,085,370 C178Y probably damaging Het
Otop1 T C 5: 38,287,948 V150A possibly damaging Het
Pclo C T 5: 14,681,749 R296* probably null Het
Pdzd2 A T 15: 12,458,058 C240S possibly damaging Het
Plekhm2 A C 4: 141,642,070 L101R probably damaging Het
Plscr3 T A 11: 69,847,994 C161S probably benign Het
Prr14l C T 5: 32,828,915 D1079N probably benign Het
Ptpru A T 4: 131,771,179 V1377E possibly damaging Het
Rab37 C A 11: 115,158,702 D112E probably benign Het
Raet1e T A 10: 22,174,375 I19N probably damaging Het
Rassf5 T C 1: 131,245,066 Y22C probably damaging Het
Rp1 T C 1: 4,346,498 T1464A probably benign Het
Safb T A 17: 56,601,092 probably benign Het
Scarf2 A G 16: 17,806,505 probably null Het
Sh3d19 T C 3: 86,106,973 S415P probably benign Het
Slc26a9 T A 1: 131,763,804 L595Q probably damaging Het
Slc4a8 T C 15: 100,796,550 Y470H probably damaging Het
Slitrk3 T C 3: 73,049,649 N597D probably benign Het
Spata31 T A 13: 64,922,213 V725E probably benign Het
Spink12 T A 18: 44,107,764 C72* probably null Het
Spink5 T A 18: 44,012,975 probably null Het
Stk40 C A 4: 126,118,332 S9* probably null Het
Sypl A T 12: 32,965,421 T40S probably damaging Het
Tbc1d8 C T 1: 39,391,209 E438K probably benign Het
Tdrd7 A G 4: 45,989,102 T111A probably benign Het
Tg A T 15: 66,741,484 probably null Het
Tlr5 T A 1: 182,973,889 W253R probably damaging Het
Tmprss11c C T 5: 86,235,469 C353Y probably damaging Het
Tnfrsf8 T A 4: 145,288,027 M271L probably benign Het
Toe1 T C 4: 116,806,750 N21S probably benign Het
Tpp2 T C 1: 43,975,447 F649L probably benign Het
Ttll1 G A 15: 83,502,225 Q60* probably null Het
Vcp C T 4: 42,982,565 R709Q probably benign Het
Vmn1r119 T A 7: 21,011,668 H263L possibly damaging Het
Vmn1r195 C A 13: 22,278,941 Q194K probably damaging Het
Vmn1r33 T C 6: 66,611,799 Y257C probably damaging Het
Vmn2r15 A G 5: 109,293,015 F326L probably benign Het
Wbp11 A T 6: 136,816,110 probably benign Het
Wwp2 T G 8: 107,517,946 V250G probably benign Het
Xpnpep3 T C 15: 81,430,837 V246A probably benign Het
Zcchc14 G A 8: 121,605,449 R419* probably null Het
Other mutations in Plekhg5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Plekhg5 APN 4 152102041 splice site probably null
IGL01025:Plekhg5 APN 4 152108526 missense probably damaging 1.00
IGL01062:Plekhg5 APN 4 152108496 missense probably damaging 1.00
IGL01138:Plekhg5 APN 4 152106978 missense probably damaging 1.00
IGL01301:Plekhg5 APN 4 152112553 missense probably benign
IGL02372:Plekhg5 APN 4 152102080 missense probably damaging 0.96
IGL02701:Plekhg5 APN 4 152103022 missense probably damaging 1.00
ANU18:Plekhg5 UTSW 4 152112553 missense probably benign
R0005:Plekhg5 UTSW 4 152112651 small deletion probably benign
R0012:Plekhg5 UTSW 4 152104750 missense probably benign 0.20
R0050:Plekhg5 UTSW 4 152108088 critical splice donor site probably null
R0233:Plekhg5 UTSW 4 152112219 missense probably damaging 1.00
R0233:Plekhg5 UTSW 4 152112219 missense probably damaging 1.00
R0234:Plekhg5 UTSW 4 152112219 missense probably damaging 1.00
R0346:Plekhg5 UTSW 4 152114253 missense probably benign 0.08
R0555:Plekhg5 UTSW 4 152107469 nonsense probably null
R0631:Plekhg5 UTSW 4 152112419 missense possibly damaging 0.89
R1372:Plekhg5 UTSW 4 152104731 missense probably damaging 0.99
R1563:Plekhg5 UTSW 4 152096809 missense probably benign 0.33
R2870:Plekhg5 UTSW 4 152107503 missense probably benign 0.01
R2870:Plekhg5 UTSW 4 152107503 missense probably benign 0.01
R2871:Plekhg5 UTSW 4 152107503 missense probably benign 0.01
R2871:Plekhg5 UTSW 4 152107503 missense probably benign 0.01
R2872:Plekhg5 UTSW 4 152107503 missense probably benign 0.01
R2872:Plekhg5 UTSW 4 152107503 missense probably benign 0.01
R2873:Plekhg5 UTSW 4 152107503 missense probably benign 0.01
R3104:Plekhg5 UTSW 4 152112178 missense probably damaging 1.00
R3106:Plekhg5 UTSW 4 152112178 missense probably damaging 1.00
R3408:Plekhg5 UTSW 4 152108292 missense probably damaging 1.00
R4289:Plekhg5 UTSW 4 152112427 missense probably benign 0.05
R5157:Plekhg5 UTSW 4 152107865 splice site probably benign
R5643:Plekhg5 UTSW 4 152104340 missense probably benign 0.14
R5644:Plekhg5 UTSW 4 152104340 missense probably benign 0.14
R5790:Plekhg5 UTSW 4 152113935 missense probably benign
R6770:Plekhg5 UTSW 4 152103079 missense probably benign
R7027:Plekhg5 UTSW 4 152113974 missense probably benign 0.01
R7039:Plekhg5 UTSW 4 152107785 missense possibly damaging 0.90
R7092:Plekhg5 UTSW 4 152114508 missense probably damaging 1.00
R7309:Plekhg5 UTSW 4 152112528 missense possibly damaging 0.50
R7319:Plekhg5 UTSW 4 152108428 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- CAGTCGGACGAATCTTCTCTCAGTAAC -3'
(R):5'- TCTGCATCTCCTTCGGGCAGAATC -3'

Sequencing Primer
(F):5'- ACGAATCTTCTCTCAGTAACACTGC -3'
(R):5'- TCTCAGATTCTGACAACTGAGGG -3'
Posted On2013-07-11