Incidental Mutation 'R0639:Pclo'
ID56896
Institutional Source Beutler Lab
Gene Symbol Pclo
Ensembl Gene ENSMUSG00000061601
Gene Namepiccolo (presynaptic cytomatrix protein)
SynonymsAcz, Pico
MMRRC Submission 038828-MU
Accession Numbers

Ncbi RefSeq: NM_011995.4; NM_001110796.1; MGI:1349390

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0639 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location14514918-14863459 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 14681749 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 296 (R296*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030691] [ENSMUST00000182407]
Predicted Effect probably null
Transcript: ENSMUST00000030691
AA Change: R3422*
SMART Domains Protein: ENSMUSP00000030691
Gene: ENSMUSG00000061601
AA Change: R3422*

DomainStartEndE-ValueType
low complexity region 4 30 N/A INTRINSIC
low complexity region 90 106 N/A INTRINSIC
internal_repeat_2 192 304 1.23e-13 PROSPERO
internal_repeat_2 305 389 1.23e-13 PROSPERO
low complexity region 393 489 N/A INTRINSIC
low complexity region 513 525 N/A INTRINSIC
Pfam:zf-piccolo 530 589 5.2e-30 PFAM
low complexity region 636 647 N/A INTRINSIC
low complexity region 657 686 N/A INTRINSIC
low complexity region 709 720 N/A INTRINSIC
low complexity region 722 738 N/A INTRINSIC
low complexity region 798 824 N/A INTRINSIC
low complexity region 825 839 N/A INTRINSIC
low complexity region 898 910 N/A INTRINSIC
low complexity region 961 978 N/A INTRINSIC
Pfam:zf-piccolo 995 1053 6.7e-33 PFAM
low complexity region 1070 1090 N/A INTRINSIC
low complexity region 1092 1107 N/A INTRINSIC
low complexity region 1150 1179 N/A INTRINSIC
internal_repeat_4 1196 1249 1.65e-5 PROSPERO
low complexity region 1275 1289 N/A INTRINSIC
low complexity region 1320 1331 N/A INTRINSIC
low complexity region 1332 1343 N/A INTRINSIC
low complexity region 1397 1411 N/A INTRINSIC
low complexity region 1444 1457 N/A INTRINSIC
low complexity region 1497 1511 N/A INTRINSIC
low complexity region 1668 1681 N/A INTRINSIC
coiled coil region 1704 1748 N/A INTRINSIC
low complexity region 1789 1800 N/A INTRINSIC
low complexity region 2046 2061 N/A INTRINSIC
low complexity region 2109 2137 N/A INTRINSIC
low complexity region 2335 2366 N/A INTRINSIC
low complexity region 2374 2389 N/A INTRINSIC
low complexity region 2413 2423 N/A INTRINSIC
low complexity region 2487 2498 N/A INTRINSIC
low complexity region 2605 2633 N/A INTRINSIC
low complexity region 2727 2738 N/A INTRINSIC
low complexity region 2792 2808 N/A INTRINSIC
low complexity region 3117 3128 N/A INTRINSIC
coiled coil region 3136 3189 N/A INTRINSIC
coiled coil region 3210 3243 N/A INTRINSIC
internal_repeat_4 3473 3521 1.65e-5 PROSPERO
coiled coil region 3688 3731 N/A INTRINSIC
low complexity region 3735 3750 N/A INTRINSIC
low complexity region 3863 3883 N/A INTRINSIC
low complexity region 3947 3961 N/A INTRINSIC
low complexity region 4004 4015 N/A INTRINSIC
low complexity region 4149 4160 N/A INTRINSIC
low complexity region 4185 4196 N/A INTRINSIC
low complexity region 4210 4225 N/A INTRINSIC
low complexity region 4229 4245 N/A INTRINSIC
PDZ 4439 4518 3.74e-14 SMART
low complexity region 4575 4602 N/A INTRINSIC
C2 4636 4750 1.44e-21 SMART
low complexity region 4764 4778 N/A INTRINSIC
low complexity region 4801 4817 N/A INTRINSIC
low complexity region 4840 4850 N/A INTRINSIC
low complexity region 4870 4892 N/A INTRINSIC
C2 4951 5057 8.56e-15 SMART
Predicted Effect probably null
Transcript: ENSMUST00000182407
AA Change: R3422*
SMART Domains Protein: ENSMUSP00000138419
Gene: ENSMUSG00000061601
AA Change: R3422*

DomainStartEndE-ValueType
low complexity region 4 30 N/A INTRINSIC
low complexity region 90 106 N/A INTRINSIC
internal_repeat_2 192 304 1.06e-13 PROSPERO
internal_repeat_2 305 389 1.06e-13 PROSPERO
low complexity region 393 489 N/A INTRINSIC
low complexity region 513 525 N/A INTRINSIC
Pfam:zf-piccolo 528 589 3e-36 PFAM
low complexity region 636 647 N/A INTRINSIC
low complexity region 657 686 N/A INTRINSIC
low complexity region 709 720 N/A INTRINSIC
low complexity region 722 738 N/A INTRINSIC
low complexity region 798 824 N/A INTRINSIC
low complexity region 825 839 N/A INTRINSIC
low complexity region 898 910 N/A INTRINSIC
low complexity region 961 978 N/A INTRINSIC
Pfam:zf-piccolo 993 1053 4.3e-37 PFAM
low complexity region 1070 1090 N/A INTRINSIC
low complexity region 1092 1107 N/A INTRINSIC
low complexity region 1150 1179 N/A INTRINSIC
internal_repeat_3 1196 1249 1.46e-5 PROSPERO
low complexity region 1275 1289 N/A INTRINSIC
low complexity region 1320 1331 N/A INTRINSIC
low complexity region 1332 1343 N/A INTRINSIC
low complexity region 1397 1411 N/A INTRINSIC
low complexity region 1444 1457 N/A INTRINSIC
low complexity region 1497 1511 N/A INTRINSIC
low complexity region 1668 1681 N/A INTRINSIC
coiled coil region 1704 1748 N/A INTRINSIC
low complexity region 1789 1800 N/A INTRINSIC
low complexity region 2046 2061 N/A INTRINSIC
low complexity region 2109 2137 N/A INTRINSIC
low complexity region 2335 2366 N/A INTRINSIC
low complexity region 2374 2389 N/A INTRINSIC
low complexity region 2413 2423 N/A INTRINSIC
low complexity region 2487 2498 N/A INTRINSIC
low complexity region 2605 2633 N/A INTRINSIC
low complexity region 2727 2738 N/A INTRINSIC
low complexity region 2792 2808 N/A INTRINSIC
low complexity region 3117 3128 N/A INTRINSIC
coiled coil region 3136 3189 N/A INTRINSIC
coiled coil region 3210 3243 N/A INTRINSIC
internal_repeat_3 3473 3521 1.46e-5 PROSPERO
coiled coil region 3688 3731 N/A INTRINSIC
low complexity region 3735 3750 N/A INTRINSIC
low complexity region 3863 3883 N/A INTRINSIC
low complexity region 3947 3961 N/A INTRINSIC
low complexity region 4004 4015 N/A INTRINSIC
low complexity region 4149 4160 N/A INTRINSIC
low complexity region 4185 4196 N/A INTRINSIC
low complexity region 4210 4225 N/A INTRINSIC
low complexity region 4229 4245 N/A INTRINSIC
PDZ 4439 4518 3.74e-14 SMART
low complexity region 4575 4602 N/A INTRINSIC
C2 4636 4750 1.44e-21 SMART
low complexity region 4764 4778 N/A INTRINSIC
low complexity region 4801 4817 N/A INTRINSIC
low complexity region 4840 4850 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182426
Predicted Effect probably null
Transcript: ENSMUST00000182915
AA Change: R296*
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype Strain: 3699630; 4442915; 4442914
Lethality: D60
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of the presynaptic cytoskeletal matrix, which is involved in establishing active synaptic zones and in synaptic vesicle trafficking. Variations in this gene have been associated with bipolar disorder and major depressive disorder. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for one deletion of Pclo are viable and fertile, and display no overt abnormal phenotype. Mice homozygous for another knock-out allele exhibit some premature lethality, decreased body size, and abnormal synaptic vesicle number. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted(5) Gene trapped(2)

Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600014C23Rik C T 17: 45,733,073 W86* probably null Het
5830411N06Rik A G 7: 140,247,959 N27D probably benign Het
Acadl T C 1: 66,857,408 H75R probably benign Het
Adamtsl1 T C 4: 86,277,143 F599S probably damaging Het
Adrb3 T C 8: 27,228,265 N52S probably damaging Het
Agbl3 T A 6: 34,799,705 L377Q probably damaging Het
Akap9 T C 5: 4,060,318 L3007P probably damaging Het
Amer3 T A 1: 34,587,821 Y380* probably null Het
Ankrd13d A T 19: 4,273,019 probably null Het
Ap4m1 T A 5: 138,176,239 C235S probably benign Het
Arhgap29 T C 3: 122,007,641 F675S probably damaging Het
Asah2 C A 19: 32,008,639 V544F probably damaging Het
Ash2l A G 8: 25,823,291 I389T possibly damaging Het
Bend5 T C 4: 111,433,298 S164P probably benign Het
Cacna1d A G 14: 30,171,294 probably null Het
Cdc25b A G 2: 131,197,262 N516D probably benign Het
Cdc27 A G 11: 104,531,734 Y125H probably damaging Het
Cdk5r2 C T 1: 74,855,836 L247F probably damaging Het
Cenpf C A 1: 189,658,062 G1191V probably benign Het
Cops4 C T 5: 100,537,460 T293I possibly damaging Het
Csmd3 A G 15: 47,913,940 L1294P probably damaging Het
Dclre1a T C 19: 56,538,440 Y848C probably damaging Het
Disp2 A T 2: 118,790,844 I686F possibly damaging Het
Dnah6 T A 6: 73,022,412 Y4012F probably benign Het
Dnajc11 C G 4: 151,969,936 R200G probably damaging Het
Dnhd1 A T 7: 105,696,464 D2272V possibly damaging Het
Elane A C 10: 79,886,349 R5S possibly damaging Het
Entpd7 G A 19: 43,691,094 V29M probably benign Het
Fanca A G 8: 123,289,359 probably null Het
Fgl1 G T 8: 41,191,624 T281K probably benign Het
Flii T C 11: 60,722,997 probably null Het
Foxn1 T C 11: 78,371,144 D133G possibly damaging Het
Fzd7 T A 1: 59,484,560 M534K probably damaging Het
Galnt5 A G 2: 57,999,395 T336A probably benign Het
Gli3 G A 13: 15,724,715 D896N probably damaging Het
Gsx1 G T 5: 147,189,946 W193L probably damaging Het
Gtpbp3 A T 8: 71,492,735 I485F probably damaging Het
H2-M11 A G 17: 36,547,391 T26A probably benign Het
Igfbp7 T C 5: 77,351,980 D243G probably damaging Het
Il31ra A T 13: 112,525,843 D477E possibly damaging Het
Inmt A C 6: 55,171,227 V139G probably damaging Het
Inpp5j T A 11: 3,501,147 M501L probably benign Het
Itsn2 T C 12: 4,712,556 F1579L probably damaging Het
Kat2b C A 17: 53,567,538 A70E probably benign Het
Klhl20 T C 1: 161,093,711 E58G probably damaging Het
Krt79 A T 15: 101,931,548 Y337* probably null Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Letm1 T C 5: 33,769,426 I176V possibly damaging Het
Lingo3 C A 10: 80,835,784 R104L probably benign Het
Lrig3 T G 10: 126,010,221 C840G probably damaging Het
Lrrc9 A G 12: 72,486,288 N977S probably damaging Het
Lrrk2 T A 15: 91,772,996 M1831K probably benign Het
Mn1 A T 5: 111,419,316 D384V probably damaging Het
Morc3 C A 16: 93,853,850 H319Q probably damaging Het
Morn1 T C 4: 155,089,503 F56L possibly damaging Het
Mrpl53 G T 6: 83,109,411 V64L probably damaging Het
Myo15 T A 11: 60,479,336 V974D probably benign Het
Neb A G 2: 52,256,124 V2947A possibly damaging Het
Nfasc A C 1: 132,603,816 N737K probably damaging Het
Nlk T C 11: 78,572,277 D464G possibly damaging Het
Nlrc4 C T 17: 74,426,963 R985K probably benign Het
Nsun6 T C 2: 14,996,336 K470E probably benign Het
Nup85 T G 11: 115,564,531 M1R probably null Het
Olfr887 G A 9: 38,085,370 C178Y probably damaging Het
Otop1 T C 5: 38,287,948 V150A possibly damaging Het
Pdzd2 A T 15: 12,458,058 C240S possibly damaging Het
Plekhg5 A G 4: 152,114,120 T922A probably benign Het
Plekhm2 A C 4: 141,642,070 L101R probably damaging Het
Plscr3 T A 11: 69,847,994 C161S probably benign Het
Prr14l C T 5: 32,828,915 D1079N probably benign Het
Ptpru A T 4: 131,771,179 V1377E possibly damaging Het
Rab37 C A 11: 115,158,702 D112E probably benign Het
Raet1e T A 10: 22,174,375 I19N probably damaging Het
Rassf5 T C 1: 131,245,066 Y22C probably damaging Het
Rp1 T C 1: 4,346,498 T1464A probably benign Het
Safb T A 17: 56,601,092 probably benign Het
Scarf2 A G 16: 17,806,505 probably null Het
Sh3d19 T C 3: 86,106,973 S415P probably benign Het
Slc26a9 T A 1: 131,763,804 L595Q probably damaging Het
Slc4a8 T C 15: 100,796,550 Y470H probably damaging Het
Slitrk3 T C 3: 73,049,649 N597D probably benign Het
Spata31 T A 13: 64,922,213 V725E probably benign Het
Spink12 T A 18: 44,107,764 C72* probably null Het
Spink5 T A 18: 44,012,975 probably null Het
Stk40 C A 4: 126,118,332 S9* probably null Het
Sypl A T 12: 32,965,421 T40S probably damaging Het
Tbc1d8 C T 1: 39,391,209 E438K probably benign Het
Tdrd7 A G 4: 45,989,102 T111A probably benign Het
Tg A T 15: 66,741,484 probably null Het
Tlr5 T A 1: 182,973,889 W253R probably damaging Het
Tmprss11c C T 5: 86,235,469 C353Y probably damaging Het
Tnfrsf8 T A 4: 145,288,027 M271L probably benign Het
Toe1 T C 4: 116,806,750 N21S probably benign Het
Tpp2 T C 1: 43,975,447 F649L probably benign Het
Ttll1 G A 15: 83,502,225 Q60* probably null Het
Vcp C T 4: 42,982,565 R709Q probably benign Het
Vmn1r119 T A 7: 21,011,668 H263L possibly damaging Het
Vmn1r195 C A 13: 22,278,941 Q194K probably damaging Het
Vmn1r33 T C 6: 66,611,799 Y257C probably damaging Het
Vmn2r15 A G 5: 109,293,015 F326L probably benign Het
Wbp11 A T 6: 136,816,110 probably benign Het
Wwp2 T G 8: 107,517,946 V250G probably benign Het
Xpnpep3 T C 15: 81,430,837 V246A probably benign Het
Zcchc14 G A 8: 121,605,449 R419* probably null Het
Other mutations in Pclo
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Pclo APN 5 14521677 nonsense probably null
IGL00429:Pclo APN 5 14680739 unclassified probably benign
IGL00498:Pclo APN 5 14540739 missense unknown
IGL00528:Pclo APN 5 14676434 unclassified probably benign
IGL00743:Pclo APN 5 14678021 unclassified probably benign
IGL00809:Pclo APN 5 14675797 missense unknown
IGL00811:Pclo APN 5 14680010 unclassified probably benign
IGL00819:Pclo APN 5 14858846 missense unknown
IGL00870:Pclo APN 5 14539983 missense unknown
IGL00925:Pclo APN 5 14766741 missense unknown
IGL00960:Pclo APN 5 14675220 missense unknown
IGL01013:Pclo APN 5 14793834 missense unknown
IGL01112:Pclo APN 5 14681069 missense unknown
IGL01124:Pclo APN 5 14714329 missense unknown
IGL01150:Pclo APN 5 14676912 unclassified probably benign
IGL01302:Pclo APN 5 14675999 unclassified probably benign
IGL01389:Pclo APN 5 14714521 missense probably damaging 0.99
IGL01448:Pclo APN 5 14676394 unclassified probably benign
IGL01449:Pclo APN 5 14678516 unclassified probably benign
IGL01450:Pclo APN 5 14677193 unclassified probably benign
IGL01476:Pclo APN 5 14521108 missense probably damaging 1.00
IGL01537:Pclo APN 5 14539633 missense unknown
IGL01568:Pclo APN 5 14678429 unclassified probably benign
IGL01574:Pclo APN 5 14713448 missense unknown
IGL01637:Pclo APN 5 14540034 missense unknown
IGL01646:Pclo APN 5 14713867 missense unknown
IGL01672:Pclo APN 5 14678535 unclassified probably benign
IGL01705:Pclo APN 5 14677865 unclassified probably benign
IGL02127:Pclo APN 5 14765145 splice site probably benign
IGL02215:Pclo APN 5 14856985 missense unknown
IGL02271:Pclo APN 5 14679494 unclassified probably benign
IGL02300:Pclo APN 5 14713741 missense unknown
IGL02346:Pclo APN 5 14677538 unclassified probably benign
IGL02449:Pclo APN 5 14515343 missense probably damaging 1.00
IGL02452:Pclo APN 5 14676966 unclassified probably benign
IGL02455:Pclo APN 5 14540175 missense unknown
IGL02478:Pclo APN 5 14766778 missense unknown
IGL02677:Pclo APN 5 14676929 unclassified probably benign
IGL02711:Pclo APN 5 14522308 missense unknown
IGL02737:Pclo APN 5 14714163 missense unknown
IGL02943:Pclo APN 5 14669221 missense unknown
IGL03184:Pclo APN 5 14714443 missense probably damaging 1.00
IGL03246:Pclo APN 5 14677617 unclassified probably benign
IGL03263:Pclo APN 5 14681810 missense unknown
IGL03300:Pclo APN 5 14712798 missense unknown
IGL03399:Pclo APN 5 14766731 missense unknown
Gauche UTSW 5 14793855 missense unknown
P0018:Pclo UTSW 5 14677721 unclassified probably benign
R0014:Pclo UTSW 5 14680451 unclassified probably benign
R0014:Pclo UTSW 5 14680451 unclassified probably benign
R0020:Pclo UTSW 5 14669673 missense unknown
R0045:Pclo UTSW 5 14539471 missense unknown
R0046:Pclo UTSW 5 14540479 missense unknown
R0046:Pclo UTSW 5 14540479 missense unknown
R0128:Pclo UTSW 5 14679797 unclassified probably benign
R0130:Pclo UTSW 5 14679797 unclassified probably benign
R0141:Pclo UTSW 5 14791922 missense unknown
R0226:Pclo UTSW 5 14765223 missense probably damaging 0.99
R0243:Pclo UTSW 5 14775420 missense unknown
R0267:Pclo UTSW 5 14681180 missense unknown
R0313:Pclo UTSW 5 14678873 unclassified probably benign
R0324:Pclo UTSW 5 14669433 missense unknown
R0331:Pclo UTSW 5 14680376 unclassified probably benign
R0370:Pclo UTSW 5 14521090 missense probably damaging 1.00
R0398:Pclo UTSW 5 14681702 missense unknown
R0401:Pclo UTSW 5 14681734 missense unknown
R0417:Pclo UTSW 5 14713022 missense unknown
R0468:Pclo UTSW 5 14677288 unclassified probably benign
R0472:Pclo UTSW 5 14681594 missense unknown
R0488:Pclo UTSW 5 14669299 missense unknown
R0511:Pclo UTSW 5 14678285 unclassified probably benign
R0511:Pclo UTSW 5 14679398 unclassified probably benign
R0520:Pclo UTSW 5 14713830 nonsense probably null
R0547:Pclo UTSW 5 14792072 missense unknown
R0611:Pclo UTSW 5 14678775 unclassified probably benign
R0611:Pclo UTSW 5 14712814 missense unknown
R0624:Pclo UTSW 5 14669656 missense unknown
R0628:Pclo UTSW 5 14669538 missense unknown
R0653:Pclo UTSW 5 14682255 intron probably benign
R0681:Pclo UTSW 5 14675318 missense unknown
R0689:Pclo UTSW 5 14714019 missense unknown
R0698:Pclo UTSW 5 14712516 missense unknown
R0737:Pclo UTSW 5 14515439 missense probably damaging 1.00
R0883:Pclo UTSW 5 14677859 nonsense probably null
R0906:Pclo UTSW 5 14676686 unclassified probably benign
R1056:Pclo UTSW 5 14540055 nonsense probably null
R1107:Pclo UTSW 5 14677869 unclassified probably benign
R1174:Pclo UTSW 5 14677646 unclassified probably benign
R1184:Pclo UTSW 5 14522262 missense unknown
R1302:Pclo UTSW 5 14681633 missense unknown
R1318:Pclo UTSW 5 14679314 unclassified probably benign
R1342:Pclo UTSW 5 14682177 intron probably benign
R1378:Pclo UTSW 5 14682313 missense probably benign 0.23
R1418:Pclo UTSW 5 14678130 unclassified probably benign
R1471:Pclo UTSW 5 14680427 unclassified probably benign
R1485:Pclo UTSW 5 14713779 missense unknown
R1523:Pclo UTSW 5 14788406 missense unknown
R1527:Pclo UTSW 5 14679648 unclassified probably benign
R1531:Pclo UTSW 5 14521903 missense probably damaging 0.99
R1537:Pclo UTSW 5 14712475 missense unknown
R1574:Pclo UTSW 5 14679831 unclassified probably benign
R1574:Pclo UTSW 5 14679831 unclassified probably benign
R1581:Pclo UTSW 5 14521282 missense probably benign 0.28
R1613:Pclo UTSW 5 14679132 unclassified probably benign
R1632:Pclo UTSW 5 14680003 unclassified probably benign
R1688:Pclo UTSW 5 14788493 critical splice donor site probably null
R1694:Pclo UTSW 5 14520963 missense probably damaging 1.00
R1707:Pclo UTSW 5 14713224 missense unknown
R1727:Pclo UTSW 5 14676987 unclassified probably benign
R1741:Pclo UTSW 5 14676510 unclassified probably benign
R1853:Pclo UTSW 5 14676684 unclassified probably benign
R1856:Pclo UTSW 5 14778552 missense probably damaging 1.00
R1907:Pclo UTSW 5 14678511 unclassified probably benign
R1970:Pclo UTSW 5 14713473 missense unknown
R1971:Pclo UTSW 5 14713473 missense unknown
R1973:Pclo UTSW 5 14676059 unclassified probably null
R1978:Pclo UTSW 5 14713795 missense unknown
R1999:Pclo UTSW 5 14677080 unclassified probably benign
R2015:Pclo UTSW 5 14521501 missense probably damaging 0.98
R2084:Pclo UTSW 5 14682148 missense probably benign 0.23
R2144:Pclo UTSW 5 14858752 missense unknown
R2155:Pclo UTSW 5 14714295 missense probably benign 0.02
R2191:Pclo UTSW 5 14713848 missense unknown
R2237:Pclo UTSW 5 14713938 missense unknown
R2276:Pclo UTSW 5 14714273 missense unknown
R2279:Pclo UTSW 5 14714273 missense unknown
R2281:Pclo UTSW 5 14540332 missense unknown
R2307:Pclo UTSW 5 14678651 unclassified probably benign
R2386:Pclo UTSW 5 14765247 missense unknown
R2407:Pclo UTSW 5 14678932 unclassified probably benign
R2512:Pclo UTSW 5 14712598 missense unknown
R2889:Pclo UTSW 5 14856981 missense unknown
R2966:Pclo UTSW 5 14681150 missense unknown
R3151:Pclo UTSW 5 14521678 missense probably damaging 0.99
R3424:Pclo UTSW 5 14680418 unclassified probably benign
R3687:Pclo UTSW 5 14668995 missense unknown
R3719:Pclo UTSW 5 14521161 missense probably benign 0.33
R3739:Pclo UTSW 5 14680899 missense unknown
R3745:Pclo UTSW 5 14678421 unclassified probably benign
R3771:Pclo UTSW 5 14539408 critical splice acceptor site probably null
R3789:Pclo UTSW 5 14680450 unclassified probably benign
R3803:Pclo UTSW 5 14515402 nonsense probably null
R3902:Pclo UTSW 5 14712522 missense probably benign 0.01
R3942:Pclo UTSW 5 14679918 unclassified probably benign
R4061:Pclo UTSW 5 14540566 missense unknown
R4094:Pclo UTSW 5 14855645 missense unknown
R4175:Pclo UTSW 5 14713875 missense probably damaging 0.99
R4195:Pclo UTSW 5 14677563 unclassified probably benign
R4398:Pclo UTSW 5 14775366 missense probably damaging 1.00
R4429:Pclo UTSW 5 14678100 unclassified probably benign
R4523:Pclo UTSW 5 14679992 unclassified probably benign
R4531:Pclo UTSW 5 14775408 missense unknown
R4552:Pclo UTSW 5 14669271 missense unknown
R4563:Pclo UTSW 5 14521369 missense probably damaging 1.00
R4581:Pclo UTSW 5 14675505 missense unknown
R4638:Pclo UTSW 5 14680433 nonsense probably null
R4655:Pclo UTSW 5 14682383 intron probably benign
R4703:Pclo UTSW 5 14676480 unclassified probably benign
R4704:Pclo UTSW 5 14676480 unclassified probably benign
R4705:Pclo UTSW 5 14676480 unclassified probably benign
R4706:Pclo UTSW 5 14714207 missense unknown
R4709:Pclo UTSW 5 14778558 missense unknown
R4755:Pclo UTSW 5 14714348 missense unknown
R4786:Pclo UTSW 5 14723267 missense unknown
R4801:Pclo UTSW 5 14675815 missense unknown
R4802:Pclo UTSW 5 14675815 missense unknown
R4812:Pclo UTSW 5 14540025 missense unknown
R4817:Pclo UTSW 5 14675031 missense unknown
R4817:Pclo UTSW 5 14713125 missense unknown
R4845:Pclo UTSW 5 14679118 unclassified probably benign
R4876:Pclo UTSW 5 14811680 missense unknown
R4907:Pclo UTSW 5 14680051 unclassified probably benign
R4943:Pclo UTSW 5 14712637 missense unknown
R4963:Pclo UTSW 5 14669221 missense unknown
R4970:Pclo UTSW 5 14677882 unclassified probably benign
R4978:Pclo UTSW 5 14714478 missense probably benign 0.23
R4982:Pclo UTSW 5 14679294 unclassified probably benign
R5019:Pclo UTSW 5 14714367 missense unknown
R5068:Pclo UTSW 5 14679073 unclassified probably benign
R5092:Pclo UTSW 5 14677308 unclassified probably benign
R5112:Pclo UTSW 5 14677882 unclassified probably benign
R5124:Pclo UTSW 5 14677392 unclassified probably benign
R5210:Pclo UTSW 5 14713450 missense probably damaging 0.99
R5227:Pclo UTSW 5 14713560 missense probably benign 0.23
R5264:Pclo UTSW 5 14676923 unclassified probably benign
R5280:Pclo UTSW 5 14540717 missense unknown
R5286:Pclo UTSW 5 14679747 unclassified probably benign
R5297:Pclo UTSW 5 14676249 unclassified probably benign
R5344:Pclo UTSW 5 14676612 unclassified probably benign
R5354:Pclo UTSW 5 14678808 unclassified probably benign
R5358:Pclo UTSW 5 14712736 nonsense probably null
R5363:Pclo UTSW 5 14669410 missense unknown
R5377:Pclo UTSW 5 14681353 missense unknown
R5457:Pclo UTSW 5 14676143 unclassified probably benign
R5468:Pclo UTSW 5 14680952 missense unknown
R5588:Pclo UTSW 5 14788398 missense unknown
R5836:Pclo UTSW 5 14678535 unclassified probably benign
R5865:Pclo UTSW 5 14714478 missense probably benign 0.23
R5875:Pclo UTSW 5 14680600 unclassified probably benign
R5892:Pclo UTSW 5 14521171 missense probably damaging 1.00
R5905:Pclo UTSW 5 14680385 unclassified probably benign
R5967:Pclo UTSW 5 14540655 missense unknown
R6046:Pclo UTSW 5 14713288 missense unknown
R6059:Pclo UTSW 5 14811700 missense unknown
R6092:Pclo UTSW 5 14677923 unclassified probably benign
R6119:Pclo UTSW 5 14677019 unclassified probably benign
R6221:Pclo UTSW 5 14675313 missense unknown
R6243:Pclo UTSW 5 14676443 unclassified probably benign
R6269:Pclo UTSW 5 14522094 nonsense probably null
R6303:Pclo UTSW 5 14677893 unclassified probably benign
R6304:Pclo UTSW 5 14677893 unclassified probably benign
R6453:Pclo UTSW 5 14676789 unclassified probably benign
R6460:Pclo UTSW 5 14679132 unclassified probably benign
R6497:Pclo UTSW 5 14793855 missense unknown
R6498:Pclo UTSW 5 14669491 missense unknown
R6524:Pclo UTSW 5 14718869 missense unknown
R6682:Pclo UTSW 5 14539879 missense unknown
R6823:Pclo UTSW 5 14677907 unclassified probably benign
R6830:Pclo UTSW 5 14681099 missense unknown
R6831:Pclo UTSW 5 14788429 nonsense probably null
R6965:Pclo UTSW 5 14681962 intron probably benign
R7012:Pclo UTSW 5 14750479 missense unknown
R7028:Pclo UTSW 5 14713447 missense unknown
R7030:Pclo UTSW 5 14676407 missense probably benign 0.23
R7130:Pclo UTSW 5 14679342 missense not run
R7141:Pclo UTSW 5 14679257 missense not run
R7143:Pclo UTSW 5 14858822 missense not run
X0058:Pclo UTSW 5 14682131 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- AAGCATGGCAGATGATCCACGG -3'
(R):5'- ACCAATCTCTAAAGGTGTTGGGCG -3'

Sequencing Primer
(F):5'- CAGATGATCCACGGAATTTAAAAAAG -3'
(R):5'- AAGTCTTTTCAGGCGCTGAAATG -3'
Posted On2013-07-11