Incidental Mutation 'R0639:Mn1'
ID56904
Institutional Source Beutler Lab
Gene Symbol Mn1
Ensembl Gene ENSMUSG00000070576
Gene Namemeningioma 1
Synonyms
MMRRC Submission 038828-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0639 (G1)
Quality Score127
Status Not validated
Chromosome5
Chromosomal Location111417362-111457033 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 111419316 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 384 (D384V)
Ref Sequence ENSEMBL: ENSMUSP00000092034 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094463]
Predicted Effect probably damaging
Transcript: ENSMUST00000094463
AA Change: D384V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092034
Gene: ENSMUSG00000070576
AA Change: D384V

DomainStartEndE-ValueType
low complexity region 92 124 N/A INTRINSIC
low complexity region 128 144 N/A INTRINSIC
low complexity region 201 217 N/A INTRINSIC
low complexity region 291 303 N/A INTRINSIC
low complexity region 333 354 N/A INTRINSIC
coiled coil region 507 548 N/A INTRINSIC
low complexity region 551 565 N/A INTRINSIC
low complexity region 569 584 N/A INTRINSIC
low complexity region 643 657 N/A INTRINSIC
low complexity region 685 704 N/A INTRINSIC
low complexity region 708 725 N/A INTRINSIC
low complexity region 727 738 N/A INTRINSIC
low complexity region 745 771 N/A INTRINSIC
low complexity region 780 791 N/A INTRINSIC
low complexity region 862 892 N/A INTRINSIC
low complexity region 913 933 N/A INTRINSIC
low complexity region 957 972 N/A INTRINSIC
low complexity region 1098 1110 N/A INTRINSIC
low complexity region 1134 1145 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138784
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196957
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Meningioma 1 (MN1) contains two sets of CAG repeats. It is disrupted by a balanced translocation (4;22) in a meningioma, and its inactivation may contribute to meningioma 32 pathogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice die shortly after birth due to cleft palate. Development of several bones in the skull was abnormal with completely absent alisphenoid, squamosal, and vomer bones, hypoplastic basisphenoid, pterygoid, and presphenoid bones, and thinfrontal, parietal, and interparietal bones. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600014C23Rik C T 17: 45,733,073 W86* probably null Het
5830411N06Rik A G 7: 140,247,959 N27D probably benign Het
Acadl T C 1: 66,857,408 H75R probably benign Het
Adamtsl1 T C 4: 86,277,143 F599S probably damaging Het
Adrb3 T C 8: 27,228,265 N52S probably damaging Het
Agbl3 T A 6: 34,799,705 L377Q probably damaging Het
Akap9 T C 5: 4,060,318 L3007P probably damaging Het
Amer3 T A 1: 34,587,821 Y380* probably null Het
Ankrd13d A T 19: 4,273,019 probably null Het
Ap4m1 T A 5: 138,176,239 C235S probably benign Het
Arhgap29 T C 3: 122,007,641 F675S probably damaging Het
Asah2 C A 19: 32,008,639 V544F probably damaging Het
Ash2l A G 8: 25,823,291 I389T possibly damaging Het
Bend5 T C 4: 111,433,298 S164P probably benign Het
Cacna1d A G 14: 30,171,294 probably null Het
Cdc25b A G 2: 131,197,262 N516D probably benign Het
Cdc27 A G 11: 104,531,734 Y125H probably damaging Het
Cdk5r2 C T 1: 74,855,836 L247F probably damaging Het
Cenpf C A 1: 189,658,062 G1191V probably benign Het
Cops4 C T 5: 100,537,460 T293I possibly damaging Het
Csmd3 A G 15: 47,913,940 L1294P probably damaging Het
Dclre1a T C 19: 56,538,440 Y848C probably damaging Het
Disp2 A T 2: 118,790,844 I686F possibly damaging Het
Dnah6 T A 6: 73,022,412 Y4012F probably benign Het
Dnajc11 C G 4: 151,969,936 R200G probably damaging Het
Dnhd1 A T 7: 105,696,464 D2272V possibly damaging Het
Elane A C 10: 79,886,349 R5S possibly damaging Het
Entpd7 G A 19: 43,691,094 V29M probably benign Het
Fanca A G 8: 123,289,359 probably null Het
Fgl1 G T 8: 41,191,624 T281K probably benign Het
Flii T C 11: 60,722,997 probably null Het
Foxn1 T C 11: 78,371,144 D133G possibly damaging Het
Fzd7 T A 1: 59,484,560 M534K probably damaging Het
Galnt5 A G 2: 57,999,395 T336A probably benign Het
Gli3 G A 13: 15,724,715 D896N probably damaging Het
Gsx1 G T 5: 147,189,946 W193L probably damaging Het
Gtpbp3 A T 8: 71,492,735 I485F probably damaging Het
H2-M11 A G 17: 36,547,391 T26A probably benign Het
Igfbp7 T C 5: 77,351,980 D243G probably damaging Het
Il31ra A T 13: 112,525,843 D477E possibly damaging Het
Inmt A C 6: 55,171,227 V139G probably damaging Het
Inpp5j T A 11: 3,501,147 M501L probably benign Het
Itsn2 T C 12: 4,712,556 F1579L probably damaging Het
Kat2b C A 17: 53,567,538 A70E probably benign Het
Klhl20 T C 1: 161,093,711 E58G probably damaging Het
Krt79 A T 15: 101,931,548 Y337* probably null Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Letm1 T C 5: 33,769,426 I176V possibly damaging Het
Lingo3 C A 10: 80,835,784 R104L probably benign Het
Lrig3 T G 10: 126,010,221 C840G probably damaging Het
Lrrc9 A G 12: 72,486,288 N977S probably damaging Het
Lrrk2 T A 15: 91,772,996 M1831K probably benign Het
Morc3 C A 16: 93,853,850 H319Q probably damaging Het
Morn1 T C 4: 155,089,503 F56L possibly damaging Het
Mrpl53 G T 6: 83,109,411 V64L probably damaging Het
Myo15 T A 11: 60,479,336 V974D probably benign Het
Neb A G 2: 52,256,124 V2947A possibly damaging Het
Nfasc A C 1: 132,603,816 N737K probably damaging Het
Nlk T C 11: 78,572,277 D464G possibly damaging Het
Nlrc4 C T 17: 74,426,963 R985K probably benign Het
Nsun6 T C 2: 14,996,336 K470E probably benign Het
Nup85 T G 11: 115,564,531 M1R probably null Het
Olfr887 G A 9: 38,085,370 C178Y probably damaging Het
Otop1 T C 5: 38,287,948 V150A possibly damaging Het
Pclo C T 5: 14,681,749 R296* probably null Het
Pdzd2 A T 15: 12,458,058 C240S possibly damaging Het
Plekhg5 A G 4: 152,114,120 T922A probably benign Het
Plekhm2 A C 4: 141,642,070 L101R probably damaging Het
Plscr3 T A 11: 69,847,994 C161S probably benign Het
Prr14l C T 5: 32,828,915 D1079N probably benign Het
Ptpru A T 4: 131,771,179 V1377E possibly damaging Het
Rab37 C A 11: 115,158,702 D112E probably benign Het
Raet1e T A 10: 22,174,375 I19N probably damaging Het
Rassf5 T C 1: 131,245,066 Y22C probably damaging Het
Rp1 T C 1: 4,346,498 T1464A probably benign Het
Safb T A 17: 56,601,092 probably benign Het
Scarf2 A G 16: 17,806,505 probably null Het
Sh3d19 T C 3: 86,106,973 S415P probably benign Het
Slc26a9 T A 1: 131,763,804 L595Q probably damaging Het
Slc4a8 T C 15: 100,796,550 Y470H probably damaging Het
Slitrk3 T C 3: 73,049,649 N597D probably benign Het
Spata31 T A 13: 64,922,213 V725E probably benign Het
Spink12 T A 18: 44,107,764 C72* probably null Het
Spink5 T A 18: 44,012,975 probably null Het
Stk40 C A 4: 126,118,332 S9* probably null Het
Sypl A T 12: 32,965,421 T40S probably damaging Het
Tbc1d8 C T 1: 39,391,209 E438K probably benign Het
Tdrd7 A G 4: 45,989,102 T111A probably benign Het
Tg A T 15: 66,741,484 probably null Het
Tlr5 T A 1: 182,973,889 W253R probably damaging Het
Tmprss11c C T 5: 86,235,469 C353Y probably damaging Het
Tnfrsf8 T A 4: 145,288,027 M271L probably benign Het
Toe1 T C 4: 116,806,750 N21S probably benign Het
Tpp2 T C 1: 43,975,447 F649L probably benign Het
Ttll1 G A 15: 83,502,225 Q60* probably null Het
Vcp C T 4: 42,982,565 R709Q probably benign Het
Vmn1r119 T A 7: 21,011,668 H263L possibly damaging Het
Vmn1r195 C A 13: 22,278,941 Q194K probably damaging Het
Vmn1r33 T C 6: 66,611,799 Y257C probably damaging Het
Vmn2r15 A G 5: 109,293,015 F326L probably benign Het
Wbp11 A T 6: 136,816,110 probably benign Het
Wwp2 T G 8: 107,517,946 V250G probably benign Het
Xpnpep3 T C 15: 81,430,837 V246A probably benign Het
Zcchc14 G A 8: 121,605,449 R419* probably null Het
Other mutations in Mn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01019:Mn1 APN 5 111421547 missense possibly damaging 0.85
IGL01139:Mn1 APN 5 111421449 missense probably damaging 0.96
IGL01546:Mn1 APN 5 111421248 missense probably damaging 1.00
IGL02252:Mn1 APN 5 111421241 missense probably damaging 0.96
IGL02821:Mn1 APN 5 111421851 missense probably damaging 0.99
IGL03203:Mn1 APN 5 111421403 missense probably benign
Uebermus UTSW 5 111421886 splice site probably null
FR4342:Mn1 UTSW 5 111419706 small insertion probably benign
FR4449:Mn1 UTSW 5 111419710 small insertion probably benign
FR4548:Mn1 UTSW 5 111419698 small insertion probably benign
FR4976:Mn1 UTSW 5 111419702 small insertion probably benign
R0676:Mn1 UTSW 5 111421034 missense possibly damaging 0.52
R1537:Mn1 UTSW 5 111454780 missense probably damaging 0.96
R1638:Mn1 UTSW 5 111421569 missense probably damaging 1.00
R1739:Mn1 UTSW 5 111420014 missense possibly damaging 0.92
R1922:Mn1 UTSW 5 111418746 missense probably damaging 0.99
R2008:Mn1 UTSW 5 111418857 missense probably damaging 1.00
R2104:Mn1 UTSW 5 111454751 missense possibly damaging 0.72
R2519:Mn1 UTSW 5 111418552 missense possibly damaging 0.85
R3980:Mn1 UTSW 5 111421770 missense possibly damaging 0.85
R4008:Mn1 UTSW 5 111420169 missense probably benign
R4564:Mn1 UTSW 5 111420667 missense possibly damaging 0.93
R4647:Mn1 UTSW 5 111420083 missense probably benign
R4779:Mn1 UTSW 5 111419660 missense probably damaging 0.99
R4819:Mn1 UTSW 5 111419937 missense possibly damaging 0.93
R4962:Mn1 UTSW 5 111454786 missense possibly damaging 0.85
R5373:Mn1 UTSW 5 111421886 splice site probably null
R5374:Mn1 UTSW 5 111421886 splice site probably null
R5521:Mn1 UTSW 5 111421769 missense possibly damaging 0.72
R5633:Mn1 UTSW 5 111420326 missense possibly damaging 0.52
R5744:Mn1 UTSW 5 111420536 missense possibly damaging 0.93
R6050:Mn1 UTSW 5 111419397 missense probably damaging 1.00
R6552:Mn1 UTSW 5 111420887 missense possibly damaging 0.93
R7206:Mn1 UTSW 5 111420512 missense possibly damaging 0.85
R7244:Mn1 UTSW 5 111418833 missense possibly damaging 0.78
Z1088:Mn1 UTSW 5 111418280 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- GGTTTGTCCAAAATGCACAGCCAG -3'
(R):5'- GAAAGTCAAAACGCGGCCTCTTG -3'

Sequencing Primer
(F):5'- GCCCGAAAGATGCCTGTG -3'
(R):5'- GGCCACGTTCATGTAAGGG -3'
Posted On2013-07-11