Incidental Mutation 'R0639:Wbp11'
ID56913
Institutional Source Beutler Lab
Gene Symbol Wbp11
Ensembl Gene ENSMUSG00000030216
Gene NameWW domain binding protein 11
SynonymsNpwbp, SIPP1, 2510026P17Rik, D6Wsu113e
MMRRC Submission 038828-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.911) question?
Stock #R0639 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location136813654-136828233 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 136816110 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145501 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000116514] [ENSMUST00000204272]
Predicted Effect unknown
Transcript: ENSMUST00000116514
AA Change: L478Q
SMART Domains Protein: ENSMUSP00000112213
Gene: ENSMUSG00000030216
AA Change: L478Q

DomainStartEndE-ValueType
Pfam:Wbp11 12 94 1e-26 PFAM
low complexity region 191 209 N/A INTRINSIC
low complexity region 263 284 N/A INTRINSIC
low complexity region 344 367 N/A INTRINSIC
low complexity region 380 532 N/A INTRINSIC
low complexity region 549 565 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151333
Predicted Effect probably benign
Transcript: ENSMUST00000204129
Predicted Effect probably benign
Transcript: ENSMUST00000204272
SMART Domains Protein: ENSMUSP00000145501
Gene: ENSMUSG00000030216

DomainStartEndE-ValueType
Pfam:Wbp11 12 94 3.8e-24 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein, which colocalizes with mRNA splicing factors and intermediate filament-containing perinuclear networks. This protein has 95% amino acid sequence identity to the mouse Wbp11 protein. It contains two proline-rich regions that bind to the WW domain of Npw38, a nuclear protein, and thus this protein is also called Npw38-binding protein NpwBP. The Npw38-NpwBP complex may function as a component of an mRNA factory in the nucleus. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600014C23Rik C T 17: 45,733,073 W86* probably null Het
5830411N06Rik A G 7: 140,247,959 N27D probably benign Het
Acadl T C 1: 66,857,408 H75R probably benign Het
Adamtsl1 T C 4: 86,277,143 F599S probably damaging Het
Adrb3 T C 8: 27,228,265 N52S probably damaging Het
Agbl3 T A 6: 34,799,705 L377Q probably damaging Het
Akap9 T C 5: 4,060,318 L3007P probably damaging Het
Amer3 T A 1: 34,587,821 Y380* probably null Het
Ankrd13d A T 19: 4,273,019 probably null Het
Ap4m1 T A 5: 138,176,239 C235S probably benign Het
Arhgap29 T C 3: 122,007,641 F675S probably damaging Het
Asah2 C A 19: 32,008,639 V544F probably damaging Het
Ash2l A G 8: 25,823,291 I389T possibly damaging Het
Bend5 T C 4: 111,433,298 S164P probably benign Het
Cacna1d A G 14: 30,171,294 probably null Het
Cdc25b A G 2: 131,197,262 N516D probably benign Het
Cdc27 A G 11: 104,531,734 Y125H probably damaging Het
Cdk5r2 C T 1: 74,855,836 L247F probably damaging Het
Cenpf C A 1: 189,658,062 G1191V probably benign Het
Cops4 C T 5: 100,537,460 T293I possibly damaging Het
Csmd3 A G 15: 47,913,940 L1294P probably damaging Het
Dclre1a T C 19: 56,538,440 Y848C probably damaging Het
Disp2 A T 2: 118,790,844 I686F possibly damaging Het
Dnah6 T A 6: 73,022,412 Y4012F probably benign Het
Dnajc11 C G 4: 151,969,936 R200G probably damaging Het
Dnhd1 A T 7: 105,696,464 D2272V possibly damaging Het
Elane A C 10: 79,886,349 R5S possibly damaging Het
Entpd7 G A 19: 43,691,094 V29M probably benign Het
Fanca A G 8: 123,289,359 probably null Het
Fgl1 G T 8: 41,191,624 T281K probably benign Het
Flii T C 11: 60,722,997 probably null Het
Foxn1 T C 11: 78,371,144 D133G possibly damaging Het
Fzd7 T A 1: 59,484,560 M534K probably damaging Het
Galnt5 A G 2: 57,999,395 T336A probably benign Het
Gli3 G A 13: 15,724,715 D896N probably damaging Het
Gsx1 G T 5: 147,189,946 W193L probably damaging Het
Gtpbp3 A T 8: 71,492,735 I485F probably damaging Het
H2-M11 A G 17: 36,547,391 T26A probably benign Het
Igfbp7 T C 5: 77,351,980 D243G probably damaging Het
Il31ra A T 13: 112,525,843 D477E possibly damaging Het
Inmt A C 6: 55,171,227 V139G probably damaging Het
Inpp5j T A 11: 3,501,147 M501L probably benign Het
Itsn2 T C 12: 4,712,556 F1579L probably damaging Het
Kat2b C A 17: 53,567,538 A70E probably benign Het
Klhl20 T C 1: 161,093,711 E58G probably damaging Het
Krt79 A T 15: 101,931,548 Y337* probably null Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Letm1 T C 5: 33,769,426 I176V possibly damaging Het
Lingo3 C A 10: 80,835,784 R104L probably benign Het
Lrig3 T G 10: 126,010,221 C840G probably damaging Het
Lrrc9 A G 12: 72,486,288 N977S probably damaging Het
Lrrk2 T A 15: 91,772,996 M1831K probably benign Het
Mn1 A T 5: 111,419,316 D384V probably damaging Het
Morc3 C A 16: 93,853,850 H319Q probably damaging Het
Morn1 T C 4: 155,089,503 F56L possibly damaging Het
Mrpl53 G T 6: 83,109,411 V64L probably damaging Het
Myo15 T A 11: 60,479,336 V974D probably benign Het
Neb A G 2: 52,256,124 V2947A possibly damaging Het
Nfasc A C 1: 132,603,816 N737K probably damaging Het
Nlk T C 11: 78,572,277 D464G possibly damaging Het
Nlrc4 C T 17: 74,426,963 R985K probably benign Het
Nsun6 T C 2: 14,996,336 K470E probably benign Het
Nup85 T G 11: 115,564,531 M1R probably null Het
Olfr887 G A 9: 38,085,370 C178Y probably damaging Het
Otop1 T C 5: 38,287,948 V150A possibly damaging Het
Pclo C T 5: 14,681,749 R296* probably null Het
Pdzd2 A T 15: 12,458,058 C240S possibly damaging Het
Plekhg5 A G 4: 152,114,120 T922A probably benign Het
Plekhm2 A C 4: 141,642,070 L101R probably damaging Het
Plscr3 T A 11: 69,847,994 C161S probably benign Het
Prr14l C T 5: 32,828,915 D1079N probably benign Het
Ptpru A T 4: 131,771,179 V1377E possibly damaging Het
Rab37 C A 11: 115,158,702 D112E probably benign Het
Raet1e T A 10: 22,174,375 I19N probably damaging Het
Rassf5 T C 1: 131,245,066 Y22C probably damaging Het
Rp1 T C 1: 4,346,498 T1464A probably benign Het
Safb T A 17: 56,601,092 probably benign Het
Scarf2 A G 16: 17,806,505 probably null Het
Sh3d19 T C 3: 86,106,973 S415P probably benign Het
Slc26a9 T A 1: 131,763,804 L595Q probably damaging Het
Slc4a8 T C 15: 100,796,550 Y470H probably damaging Het
Slitrk3 T C 3: 73,049,649 N597D probably benign Het
Spata31 T A 13: 64,922,213 V725E probably benign Het
Spink12 T A 18: 44,107,764 C72* probably null Het
Spink5 T A 18: 44,012,975 probably null Het
Stk40 C A 4: 126,118,332 S9* probably null Het
Sypl A T 12: 32,965,421 T40S probably damaging Het
Tbc1d8 C T 1: 39,391,209 E438K probably benign Het
Tdrd7 A G 4: 45,989,102 T111A probably benign Het
Tg A T 15: 66,741,484 probably null Het
Tlr5 T A 1: 182,973,889 W253R probably damaging Het
Tmprss11c C T 5: 86,235,469 C353Y probably damaging Het
Tnfrsf8 T A 4: 145,288,027 M271L probably benign Het
Toe1 T C 4: 116,806,750 N21S probably benign Het
Tpp2 T C 1: 43,975,447 F649L probably benign Het
Ttll1 G A 15: 83,502,225 Q60* probably null Het
Vcp C T 4: 42,982,565 R709Q probably benign Het
Vmn1r119 T A 7: 21,011,668 H263L possibly damaging Het
Vmn1r195 C A 13: 22,278,941 Q194K probably damaging Het
Vmn1r33 T C 6: 66,611,799 Y257C probably damaging Het
Vmn2r15 A G 5: 109,293,015 F326L probably benign Het
Wwp2 T G 8: 107,517,946 V250G probably benign Het
Xpnpep3 T C 15: 81,430,837 V246A probably benign Het
Zcchc14 G A 8: 121,605,449 R419* probably null Het
Other mutations in Wbp11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Wbp11 APN 6 136821670 intron probably benign
IGL01408:Wbp11 APN 6 136814614 unclassified probably benign
R0685:Wbp11 UTSW 6 136814638 unclassified probably benign
R1264:Wbp11 UTSW 6 136814515 unclassified probably benign
R1987:Wbp11 UTSW 6 136820585 missense probably damaging 0.99
R2362:Wbp11 UTSW 6 136824332 missense probably damaging 1.00
R4646:Wbp11 UTSW 6 136821191 missense probably benign 0.10
R5682:Wbp11 UTSW 6 136814254 unclassified probably benign
R6045:Wbp11 UTSW 6 136821535 missense probably damaging 0.99
R6386:Wbp11 UTSW 6 136820525 missense probably benign 0.36
R6567:Wbp11 UTSW 6 136820539 missense probably benign 0.02
R7132:Wbp11 UTSW 6 136821542 missense probably benign 0.24
Predicted Primers PCR Primer
(F):5'- AGGCTCGTGCAGAACACACTTTCC -3'
(R):5'- TATTGTGACAGACTAGCCCAGCCC -3'

Sequencing Primer
(F):5'- TGCCTAGCTCTTGTCACACT -3'
(R):5'- GTGTTGCTTAATACAGTCTCACG -3'
Posted On2013-07-11