Incidental Mutation 'R7329:Nkain2'
ID569130
Institutional Source Beutler Lab
Gene Symbol Nkain2
Ensembl Gene ENSMUSG00000069670
Gene NameNa+/K+ transporting ATPase interacting 2
Synonyms6330571D19Rik, Tcba1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R7329 (G1)
Quality Score184.468
Status Not validated
Chromosome10
Chromosomal Location31689310-32890462 bp(-) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) TTTACTCGTT to TTT at 32889896 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000090264 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092602] [ENSMUST00000191234] [ENSMUST00000218645] [ENSMUST00000219125]
Predicted Effect probably null
Transcript: ENSMUST00000092602
SMART Domains Protein: ENSMUSP00000090264
Gene: ENSMUSG00000069670

DomainStartEndE-ValueType
low complexity region 17 33 N/A INTRINSIC
low complexity region 87 112 N/A INTRINSIC
low complexity region 125 159 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191234
SMART Domains Protein: ENSMUSP00000140463
Gene: ENSMUSG00000069670

DomainStartEndE-ValueType
Pfam:NKAIN 1 208 4.1e-109 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000218645
Predicted Effect probably benign
Transcript: ENSMUST00000219125
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein that interacts with the beta subunit of a sodium/potassium-transporting ATPase. A chromosomal translocation involving this gene is a cause of lymphoma. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019N19Rik T C 19: 58,789,222 E52G probably damaging Het
Actb T C 5: 142,904,391 N252S probably benign Het
Adgrb1 C A 15: 74,539,245 T330K probably damaging Het
Ahnak A G 19: 9,001,792 T147A probably damaging Het
Ankfy1 T C 11: 72,712,208 V21A probably damaging Het
Arrdc4 T A 7: 68,741,027 N322Y probably damaging Het
Bfsp2 C A 9: 103,449,922 E205D probably benign Het
C2cd4b T A 9: 67,760,137 S138R possibly damaging Het
Camkk1 C G 11: 73,027,047 N147K probably damaging Het
Ckap2l T A 2: 129,285,364 Q298L possibly damaging Het
Clstn2 G T 9: 97,461,369 A675D probably benign Het
Cntnap2 G A 6: 47,271,271 V1204M possibly damaging Het
Col4a1 C T 8: 11,226,494 probably null Het
Ctrc T C 4: 141,843,711 T73A probably benign Het
Cubn A G 2: 13,468,771 F454L probably damaging Het
Cuedc1 A T 11: 88,169,866 S12C unknown Het
Cyb561a3 G T 19: 10,587,904 G211C probably damaging Het
D5Ertd579e A T 5: 36,616,395 S219T probably benign Het
Dennd4c C T 4: 86,779,874 P200S possibly damaging Het
Dennd4c T A 4: 86,841,081 Y1783N probably damaging Het
Dnah6 G A 6: 73,144,722 Q1426* probably null Het
Dync2h1 T G 9: 7,011,247 T3649P probably benign Het
E2f8 T C 7: 48,872,110 S415G probably damaging Het
Fbxo22 A G 9: 55,214,977 I147V probably benign Het
Gclc A G 9: 77,776,191 Y110C probably damaging Het
Gm15922 G A 7: 3,739,876 probably benign Het
Gstm5 A G 3: 107,896,331 T27A possibly damaging Het
Heatr4 A G 12: 83,978,082 S322P probably benign Het
Htt T A 5: 34,829,755 I1106N probably benign Het
Hunk T C 16: 90,386,682 V76A probably benign Het
Igkv12-98 C T 6: 68,571,103 T72I possibly damaging Het
Igkv9-123 A T 6: 67,954,645 W16R possibly damaging Het
Ipo7 T C 7: 110,049,017 L674S possibly damaging Het
Kcnh6 T C 11: 106,017,377 F273S probably benign Het
Lamb3 C A 1: 193,320,540 Q98K possibly damaging Het
Lingo4 A T 3: 94,402,855 T367S probably benign Het
Lypd6b A T 2: 49,942,500 I26F probably benign Het
Maneal T C 4: 124,856,719 T415A probably benign Het
Mapk1ip1l A G 14: 47,310,463 T23A unknown Het
Mrps17 T A 5: 129,716,641 probably benign Het
Mup13 T G 4: 61,227,689 D45A probably damaging Het
Mycbpap T A 11: 94,509,247 D408V probably damaging Het
Myh10 A G 11: 68,810,191 H1742R probably benign Het
Mylk4 A G 13: 32,716,783 Y255H probably damaging Het
Nbeal1 A G 1: 60,217,196 Q200R probably benign Het
Olfm4 T C 14: 80,011,929 V162A possibly damaging Het
Olfr1151 T C 2: 87,857,241 V22A probably benign Het
Olfr251 C A 9: 38,378,160 T87K probably benign Het
Olfr344 A G 2: 36,568,696 T33A probably benign Het
Olfr570 T C 7: 102,900,832 L155P probably damaging Het
Ovol3 T A 7: 30,235,252 R43S probably benign Het
Pcbp1 A G 6: 86,525,116 V267A probably benign Het
Phf20 T A 2: 156,304,632 V903E probably damaging Het
Pi4k2b T G 5: 52,756,869 S316A probably benign Het
Pkhd1 A T 1: 20,547,519 H947Q probably damaging Het
Prkca T A 11: 108,014,277 T212S possibly damaging Het
Psg16 A T 7: 17,090,686 I41F possibly damaging Het
Rae1 T A 2: 173,009,445 F204I probably benign Het
Rasef T A 4: 73,744,137 N192I probably damaging Het
Rfc1 T A 5: 65,263,135 R1122S unknown Het
Rfx2 A T 17: 56,803,681 S102T probably benign Het
Sez6l A G 5: 112,440,907 Y647H probably damaging Het
Siglecf A G 7: 43,351,971 Y121C probably damaging Het
Slc27a5 T C 7: 12,991,162 T453A possibly damaging Het
Slc44a2 G A 9: 21,342,752 R171Q probably damaging Het
Slc4a9 A C 18: 36,540,821 E889A possibly damaging Het
Snx31 C A 15: 36,555,476 R13L probably benign Het
Spag6l A T 16: 16,767,019 Y422N probably benign Het
Sulf2 T C 2: 166,117,088 T67A probably damaging Het
Syne2 G A 12: 75,966,984 R2983Q probably benign Het
Tmtc3 A G 10: 100,447,419 I758T probably benign Het
Top2a T A 11: 99,004,246 I843L possibly damaging Het
Trdmt1 A G 2: 13,516,122 L323P probably damaging Het
Ush2a A T 1: 188,553,198 E1977V probably damaging Het
Utp4 A G 8: 106,913,463 E468G probably benign Het
Uts2r A G 11: 121,160,732 T141A possibly damaging Het
Vmn1r230 A G 17: 20,846,690 Y47C probably damaging Het
Other mutations in Nkain2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01408:Nkain2 APN 10 32402241 missense probably damaging 1.00
IGL02937:Nkain2 APN 10 32329844 missense probably damaging 1.00
R1395:Nkain2 UTSW 10 32890189 unclassified probably benign
R1876:Nkain2 UTSW 10 32890439 unclassified probably benign
R1995:Nkain2 UTSW 10 32402351 missense possibly damaging 0.84
R2000:Nkain2 UTSW 10 32890285 unclassified probably benign
R2101:Nkain2 UTSW 10 32329817 missense possibly damaging 0.74
R5514:Nkain2 UTSW 10 31951193 missense probably damaging 1.00
R5801:Nkain2 UTSW 10 32402268 missense probably damaging 0.99
R6024:Nkain2 UTSW 10 31951285 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AATAACCCATGGTTTCCGAGACC -3'
(R):5'- ATCCGCTCATCTAGGCAAGG -3'

Sequencing Primer
(F):5'- ATGGTTTCCGAGACCCCTGC -3'
(R):5'- CGCTCATCTAGGCAAGGGGAAG -3'
Posted On2019-09-13