Incidental Mutation 'R0639:Fanca'
ID56924
Institutional Source Beutler Lab
Gene Symbol Fanca
Ensembl Gene ENSMUSG00000032815
Gene NameFanconi anemia, complementation group A
Synonyms
MMRRC Submission 038828-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.752) question?
Stock #R0639 (G1)
Quality Score188
Status Not validated
Chromosome8
Chromosomal Location123268300-123318576 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 123289359 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116614 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035495] [ENSMUST00000035495] [ENSMUST00000127664] [ENSMUST00000127904] [ENSMUST00000127904] [ENSMUST00000127904] [ENSMUST00000127904]
Predicted Effect probably null
Transcript: ENSMUST00000035495
SMART Domains Protein: ENSMUSP00000045217
Gene: ENSMUSG00000032815

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 78 100 N/A INTRINSIC
Pfam:Fanconi_A_N 167 520 3.7e-146 PFAM
low complexity region 645 660 N/A INTRINSIC
low complexity region 778 790 N/A INTRINSIC
low complexity region 1069 1079 N/A INTRINSIC
low complexity region 1200 1225 N/A INTRINSIC
Pfam:Fanconi_A 1246 1308 8.4e-36 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000035495
SMART Domains Protein: ENSMUSP00000045217
Gene: ENSMUSG00000032815

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 78 100 N/A INTRINSIC
Pfam:Fanconi_A_N 167 520 3.7e-146 PFAM
low complexity region 645 660 N/A INTRINSIC
low complexity region 778 790 N/A INTRINSIC
low complexity region 1069 1079 N/A INTRINSIC
low complexity region 1200 1225 N/A INTRINSIC
Pfam:Fanconi_A 1246 1308 8.4e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably null
Transcript: ENSMUST00000127904
SMART Domains Protein: ENSMUSP00000116614
Gene: ENSMUSG00000032815

DomainStartEndE-ValueType
low complexity region 547 562 N/A INTRINSIC
low complexity region 680 692 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000127904
SMART Domains Protein: ENSMUSP00000116614
Gene: ENSMUSG00000032815

DomainStartEndE-ValueType
low complexity region 547 562 N/A INTRINSIC
low complexity region 680 692 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000127904
SMART Domains Protein: ENSMUSP00000116614
Gene: ENSMUSG00000032815

DomainStartEndE-ValueType
low complexity region 547 562 N/A INTRINSIC
low complexity region 680 692 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000127904
SMART Domains Protein: ENSMUSP00000116614
Gene: ENSMUSG00000032815

DomainStartEndE-ValueType
low complexity region 547 562 N/A INTRINSIC
low complexity region 680 692 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133950
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155488
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212953
Meta Mutation Damage Score 0.544 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group A. Alternative splicing results in multiple transcript variants encoding different isoforms. Mutations in this gene are the most common cause of Fanconi anemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutants show variably: growth retardation, microphthalmia, craniofacial malformations and hematological changes, depending on allele and strain background. Both sexes show hypogonadism, including diminished primordial germ cells and impaired fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600014C23Rik C T 17: 45,733,073 W86* probably null Het
5830411N06Rik A G 7: 140,247,959 N27D probably benign Het
Acadl T C 1: 66,857,408 H75R probably benign Het
Adamtsl1 T C 4: 86,277,143 F599S probably damaging Het
Adrb3 T C 8: 27,228,265 N52S probably damaging Het
Agbl3 T A 6: 34,799,705 L377Q probably damaging Het
Akap9 T C 5: 4,060,318 L3007P probably damaging Het
Amer3 T A 1: 34,587,821 Y380* probably null Het
Ankrd13d A T 19: 4,273,019 probably null Het
Ap4m1 T A 5: 138,176,239 C235S probably benign Het
Arhgap29 T C 3: 122,007,641 F675S probably damaging Het
Asah2 C A 19: 32,008,639 V544F probably damaging Het
Ash2l A G 8: 25,823,291 I389T possibly damaging Het
Bend5 T C 4: 111,433,298 S164P probably benign Het
Cacna1d A G 14: 30,171,294 probably null Het
Cdc25b A G 2: 131,197,262 N516D probably benign Het
Cdc27 A G 11: 104,531,734 Y125H probably damaging Het
Cdk5r2 C T 1: 74,855,836 L247F probably damaging Het
Cenpf C A 1: 189,658,062 G1191V probably benign Het
Cops4 C T 5: 100,537,460 T293I possibly damaging Het
Csmd3 A G 15: 47,913,940 L1294P probably damaging Het
Dclre1a T C 19: 56,538,440 Y848C probably damaging Het
Disp2 A T 2: 118,790,844 I686F possibly damaging Het
Dnah6 T A 6: 73,022,412 Y4012F probably benign Het
Dnajc11 C G 4: 151,969,936 R200G probably damaging Het
Dnhd1 A T 7: 105,696,464 D2272V possibly damaging Het
Elane A C 10: 79,886,349 R5S possibly damaging Het
Entpd7 G A 19: 43,691,094 V29M probably benign Het
Fgl1 G T 8: 41,191,624 T281K probably benign Het
Flii T C 11: 60,722,997 probably null Het
Foxn1 T C 11: 78,371,144 D133G possibly damaging Het
Fzd7 T A 1: 59,484,560 M534K probably damaging Het
Galnt5 A G 2: 57,999,395 T336A probably benign Het
Gli3 G A 13: 15,724,715 D896N probably damaging Het
Gsx1 G T 5: 147,189,946 W193L probably damaging Het
Gtpbp3 A T 8: 71,492,735 I485F probably damaging Het
H2-M11 A G 17: 36,547,391 T26A probably benign Het
Igfbp7 T C 5: 77,351,980 D243G probably damaging Het
Il31ra A T 13: 112,525,843 D477E possibly damaging Het
Inmt A C 6: 55,171,227 V139G probably damaging Het
Inpp5j T A 11: 3,501,147 M501L probably benign Het
Itsn2 T C 12: 4,712,556 F1579L probably damaging Het
Kat2b C A 17: 53,567,538 A70E probably benign Het
Klhl20 T C 1: 161,093,711 E58G probably damaging Het
Krt79 A T 15: 101,931,548 Y337* probably null Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Letm1 T C 5: 33,769,426 I176V possibly damaging Het
Lingo3 C A 10: 80,835,784 R104L probably benign Het
Lrig3 T G 10: 126,010,221 C840G probably damaging Het
Lrrc9 A G 12: 72,486,288 N977S probably damaging Het
Lrrk2 T A 15: 91,772,996 M1831K probably benign Het
Mn1 A T 5: 111,419,316 D384V probably damaging Het
Morc3 C A 16: 93,853,850 H319Q probably damaging Het
Morn1 T C 4: 155,089,503 F56L possibly damaging Het
Mrpl53 G T 6: 83,109,411 V64L probably damaging Het
Myo15 T A 11: 60,479,336 V974D probably benign Het
Neb A G 2: 52,256,124 V2947A possibly damaging Het
Nfasc A C 1: 132,603,816 N737K probably damaging Het
Nlk T C 11: 78,572,277 D464G possibly damaging Het
Nlrc4 C T 17: 74,426,963 R985K probably benign Het
Nsun6 T C 2: 14,996,336 K470E probably benign Het
Nup85 T G 11: 115,564,531 M1R probably null Het
Olfr887 G A 9: 38,085,370 C178Y probably damaging Het
Otop1 T C 5: 38,287,948 V150A possibly damaging Het
Pclo C T 5: 14,681,749 R296* probably null Het
Pdzd2 A T 15: 12,458,058 C240S possibly damaging Het
Plekhg5 A G 4: 152,114,120 T922A probably benign Het
Plekhm2 A C 4: 141,642,070 L101R probably damaging Het
Plscr3 T A 11: 69,847,994 C161S probably benign Het
Prr14l C T 5: 32,828,915 D1079N probably benign Het
Ptpru A T 4: 131,771,179 V1377E possibly damaging Het
Rab37 C A 11: 115,158,702 D112E probably benign Het
Raet1e T A 10: 22,174,375 I19N probably damaging Het
Rassf5 T C 1: 131,245,066 Y22C probably damaging Het
Rp1 T C 1: 4,346,498 T1464A probably benign Het
Safb T A 17: 56,601,092 probably benign Het
Scarf2 A G 16: 17,806,505 probably null Het
Sh3d19 T C 3: 86,106,973 S415P probably benign Het
Slc26a9 T A 1: 131,763,804 L595Q probably damaging Het
Slc4a8 T C 15: 100,796,550 Y470H probably damaging Het
Slitrk3 T C 3: 73,049,649 N597D probably benign Het
Spata31 T A 13: 64,922,213 V725E probably benign Het
Spink12 T A 18: 44,107,764 C72* probably null Het
Spink5 T A 18: 44,012,975 probably null Het
Stk40 C A 4: 126,118,332 S9* probably null Het
Sypl A T 12: 32,965,421 T40S probably damaging Het
Tbc1d8 C T 1: 39,391,209 E438K probably benign Het
Tdrd7 A G 4: 45,989,102 T111A probably benign Het
Tg A T 15: 66,741,484 probably null Het
Tlr5 T A 1: 182,973,889 W253R probably damaging Het
Tmprss11c C T 5: 86,235,469 C353Y probably damaging Het
Tnfrsf8 T A 4: 145,288,027 M271L probably benign Het
Toe1 T C 4: 116,806,750 N21S probably benign Het
Tpp2 T C 1: 43,975,447 F649L probably benign Het
Ttll1 G A 15: 83,502,225 Q60* probably null Het
Vcp C T 4: 42,982,565 R709Q probably benign Het
Vmn1r119 T A 7: 21,011,668 H263L possibly damaging Het
Vmn1r195 C A 13: 22,278,941 Q194K probably damaging Het
Vmn1r33 T C 6: 66,611,799 Y257C probably damaging Het
Vmn2r15 A G 5: 109,293,015 F326L probably benign Het
Wbp11 A T 6: 136,816,110 probably benign Het
Wwp2 T G 8: 107,517,946 V250G probably benign Het
Xpnpep3 T C 15: 81,430,837 V246A probably benign Het
Zcchc14 G A 8: 121,605,449 R419* probably null Het
Other mutations in Fanca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02348:Fanca APN 8 123305263 missense probably damaging 1.00
IGL02805:Fanca APN 8 123289494 missense probably damaging 0.99
IGL03280:Fanca APN 8 123316459 unclassified probably benign
PIT4402001:Fanca UTSW 8 123313064 missense possibly damaging 0.83
R0114:Fanca UTSW 8 123288491 splice site probably null
R0115:Fanca UTSW 8 123268539 missense probably benign 0.00
R0271:Fanca UTSW 8 123272441 unclassified probably benign
R0330:Fanca UTSW 8 123274172 nonsense probably null
R0345:Fanca UTSW 8 123304813 missense probably damaging 1.00
R0570:Fanca UTSW 8 123306430 missense probably benign 0.01
R0601:Fanca UTSW 8 123308513 missense probably damaging 0.99
R0617:Fanca UTSW 8 123288070 missense probably damaging 0.99
R0943:Fanca UTSW 8 123274186 missense probably damaging 1.00
R1140:Fanca UTSW 8 123313129 splice site probably null
R1364:Fanca UTSW 8 123304281 splice site probably benign
R1366:Fanca UTSW 8 123304281 splice site probably benign
R1367:Fanca UTSW 8 123304281 splice site probably benign
R1368:Fanca UTSW 8 123304281 splice site probably benign
R1969:Fanca UTSW 8 123288064 missense probably benign 0.41
R1992:Fanca UTSW 8 123297812 missense possibly damaging 0.94
R2060:Fanca UTSW 8 123274481 missense probably damaging 1.00
R2174:Fanca UTSW 8 123271270 missense probably benign 0.00
R2261:Fanca UTSW 8 123289359 critical splice donor site probably null
R3957:Fanca UTSW 8 123316363 missense probably benign 0.00
R4062:Fanca UTSW 8 123275172 missense probably benign 0.00
R4153:Fanca UTSW 8 123304878 missense possibly damaging 0.89
R4270:Fanca UTSW 8 123268794 missense probably damaging 1.00
R4424:Fanca UTSW 8 123288793 missense probably benign 0.11
R4581:Fanca UTSW 8 123274338 unclassified probably null
R4639:Fanca UTSW 8 123318150 missense probably damaging 0.98
R4664:Fanca UTSW 8 123268972 missense probably damaging 0.99
R4665:Fanca UTSW 8 123268972 missense probably damaging 0.99
R4666:Fanca UTSW 8 123268972 missense probably damaging 0.99
R4686:Fanca UTSW 8 123268934 splice site probably benign
R4775:Fanca UTSW 8 123296306 missense probably damaging 0.99
R4782:Fanca UTSW 8 123288202 missense probably damaging 1.00
R4799:Fanca UTSW 8 123288202 missense probably damaging 1.00
R4926:Fanca UTSW 8 123303985 missense probably benign 0.05
R4973:Fanca UTSW 8 123308522 missense probably damaging 0.96
R5039:Fanca UTSW 8 123284046 missense probably benign
R5195:Fanca UTSW 8 123303945 intron probably benign
R5590:Fanca UTSW 8 123303963 intron probably benign
R5848:Fanca UTSW 8 123295053 intron probably benign
R5965:Fanca UTSW 8 123316410 missense possibly damaging 0.46
R6224:Fanca UTSW 8 123305281 missense possibly damaging 0.87
R6385:Fanca UTSW 8 123305867 unclassified probably null
R6762:Fanca UTSW 8 123271303 missense probably benign 0.26
R6795:Fanca UTSW 8 123318493 missense probably benign 0.02
R6810:Fanca UTSW 8 123286477 missense probably damaging 0.99
R7153:Fanca UTSW 8 123316425 missense probably damaging 1.00
R7170:Fanca UTSW 8 123271206 missense probably damaging 1.00
R7204:Fanca UTSW 8 123286477 missense probably damaging 0.98
R7366:Fanca UTSW 8 123281213 missense probably benign 0.08
V7732:Fanca UTSW 8 123304281 splice site probably benign
X0025:Fanca UTSW 8 123276548 intron probably benign
X0062:Fanca UTSW 8 123304852 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TGAAGCTGCTTCGTGGGAAGAC -3'
(R):5'- ACGCTGTCGCTTGGTTACATCG -3'

Sequencing Primer
(F):5'- ATGGGCTCTGGTGCTACAAAC -3'
(R):5'- GTTCTTTCCATGCCTTACATAACTG -3'
Posted On2013-07-11