Incidental Mutation 'R7332:Slco3a1'
ID569299
Institutional Source Beutler Lab
Gene Symbol Slco3a1
Ensembl Gene ENSMUSG00000025790
Gene Namesolute carrier organic anion transporter family, member 3a1
SynonymsOATP-D, Slc21a11, 5830414C08Rik, MJAM, Anr1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.246) question?
Stock #R7332 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location74275419-74554780 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 74318484 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 496 (A496V)
Ref Sequence ENSEMBL: ENSMUSP00000026897 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026897] [ENSMUST00000098371] [ENSMUST00000107453]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026897
AA Change: A496V

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000026897
Gene: ENSMUSG00000025790
AA Change: A496V

DomainStartEndE-ValueType
low complexity region 7 16 N/A INTRINSIC
Pfam:MFS_1 44 455 1.2e-27 PFAM
KAZAL 474 509 2.77e-1 SMART
low complexity region 574 594 N/A INTRINSIC
transmembrane domain 626 648 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000098371
AA Change: A496V

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000095973
Gene: ENSMUSG00000025790
AA Change: A496V

DomainStartEndE-ValueType
low complexity region 7 16 N/A INTRINSIC
Pfam:MFS_1 44 456 1.2e-27 PFAM
KAZAL 474 509 2.77e-1 SMART
low complexity region 574 594 N/A INTRINSIC
transmembrane domain 626 648 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107453
AA Change: A496V

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000103077
Gene: ENSMUSG00000025790
AA Change: A496V

DomainStartEndE-ValueType
low complexity region 7 16 N/A INTRINSIC
Pfam:MFS_1 45 456 2e-27 PFAM
KAZAL 474 509 2.77e-1 SMART
low complexity region 574 589 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afap1l2 A G 19: 56,918,121 S449P probably damaging Het
Atp6v0c A C 17: 24,169,224 S21A probably benign Het
Cacna1e T C 1: 154,725,801 Y40C possibly damaging Het
Cdadc1 A G 14: 59,575,764 I398T possibly damaging Het
Cfap44 T A 16: 44,429,828 D756E probably damaging Het
Clcnkb A T 4: 141,413,932 L104Q probably null Het
Clk1 G A 1: 58,412,694 H421Y probably benign Het
Cmpk2 A T 12: 26,478,062 D426V probably damaging Het
Cmya5 A G 13: 93,092,553 L2009S possibly damaging Het
Col5a2 C G 1: 45,380,165 D1252H probably damaging Het
Coro1b A G 19: 4,149,357 K5R probably benign Het
Csmd2 A G 4: 128,419,567 T1346A Het
Csrp1 G T 1: 135,739,411 W4L probably benign Het
Cyp3a25 A G 5: 145,993,007 I184T probably damaging Het
Egfl7 C A 2: 26,590,713 R128S probably benign Het
Fggy A T 4: 95,623,482 N157I probably damaging Het
Gldc A T 19: 30,116,526 L697Q probably damaging Het
Gm10436 T C 12: 88,176,417 T339A possibly damaging Het
Gm4952 T A 19: 12,627,009 Y262N probably damaging Het
Gsap T A 5: 21,290,121 M821K probably benign Het
Hsbp1l1 T C 18: 80,236,823 probably benign Het
Igfbp7 G A 5: 77,351,956 T220I probably damaging Het
Ints3 T C 3: 90,415,512 Q137R probably damaging Het
Kcna6 A G 6: 126,739,329 F199S possibly damaging Het
Kirrel T C 3: 87,088,398 I410V probably benign Het
Llgl2 T C 11: 115,848,299 V332A probably damaging Het
Lrrc27 A G 7: 139,242,745 I517M probably damaging Het
Mas1 T C 17: 12,842,219 T106A probably benign Het
Mast4 T A 13: 102,751,424 Y1159F possibly damaging Het
Mmp2 A G 8: 92,850,152 D601G probably damaging Het
Mycbp2 A G 14: 103,156,453 S2891P probably damaging Het
Mycbp2 T A 14: 103,197,357 I2217F probably damaging Het
Naip6 A G 13: 100,300,701 V438A possibly damaging Het
Olfr1284 A G 2: 111,379,393 H131R not run Het
Pdf T C 8: 107,048,541 R20G probably benign Het
Perm1 TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT 4: 156,218,068 probably benign Het
Pfdn2 T C 1: 171,356,594 L47P probably damaging Het
Pik3c2g C A 6: 139,896,255 N795K Het
Ppip5k1 A T 2: 121,311,969 V1333D probably damaging Het
Prss44 A T 9: 110,815,462 I213F probably damaging Het
Rbm47 A G 5: 66,026,214 Y349H probably damaging Het
Rcl1 A T 19: 29,130,696 T253S probably benign Het
Rdh1 A G 10: 127,759,885 probably benign Het
Scn7a C T 2: 66,692,554 W935* probably null Het
Sec24b T C 3: 130,041,393 N52S probably benign Het
Serpinb5 A T 1: 106,872,361 I94L probably benign Het
Setx T C 2: 29,146,626 V1041A probably benign Het
Spag5 T A 11: 78,313,379 L486* probably null Het
Spink5 T C 18: 43,982,250 I183T probably damaging Het
Srd5a1 T C 13: 69,611,054 Y65C probably benign Het
Ssh2 T A 11: 77,453,523 I778N possibly damaging Het
Sstr1 C T 12: 58,213,386 S265L probably damaging Het
Syne2 T A 12: 75,967,755 probably null Het
Tctn1 A T 5: 122,261,484 D92E probably damaging Het
Tiam2 A G 17: 3,453,369 I940M probably damaging Het
Tmeff2 T C 1: 50,979,440 W194R unknown Het
Tomm20 T C 8: 126,937,153 T94A probably benign Het
Ucn2 A G 9: 108,986,464 N98S probably benign Het
V1rd19 A T 7: 24,003,318 I70L probably benign Het
Vmn1r18 A G 6: 57,390,518 L17P probably benign Het
Vmn2r61 A G 7: 42,260,110 T20A probably benign Het
Wdr59 G A 8: 111,494,354 T182I Het
Zfp40 A T 17: 23,176,181 C477* probably null Het
Zfp68 A G 5: 138,606,568 S498P possibly damaging Het
Zfp846 T G 9: 20,594,225 N460K probably benign Het
Zim1 T C 7: 6,677,353 Y437C probably damaging Het
Other mutations in Slco3a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Slco3a1 APN 7 74504183 missense probably damaging 1.00
IGL01124:Slco3a1 APN 7 74284547 missense probably damaging 1.00
IGL01583:Slco3a1 APN 7 74284450 missense probably benign 0.01
IGL01929:Slco3a1 APN 7 74318605 splice site probably benign
IGL01991:Slco3a1 APN 7 74284396 missense possibly damaging 0.84
IGL02380:Slco3a1 APN 7 74554490 missense probably damaging 1.00
IGL03269:Slco3a1 APN 7 74318532 missense possibly damaging 0.58
R0052:Slco3a1 UTSW 7 74504326 missense probably benign 0.00
R0052:Slco3a1 UTSW 7 74504326 missense probably benign 0.00
R0317:Slco3a1 UTSW 7 74504426 missense probably damaging 1.00
R0545:Slco3a1 UTSW 7 74320553 nonsense probably null
R0613:Slco3a1 UTSW 7 74346634 unclassified probably benign
R1488:Slco3a1 UTSW 7 74346701 missense possibly damaging 0.94
R1506:Slco3a1 UTSW 7 74359935 intron probably null
R1571:Slco3a1 UTSW 7 74504380 missense possibly damaging 0.92
R1912:Slco3a1 UTSW 7 74504611 missense probably damaging 1.00
R2011:Slco3a1 UTSW 7 74346671 missense probably benign 0.08
R2382:Slco3a1 UTSW 7 74346776 missense probably benign 0.00
R3735:Slco3a1 UTSW 7 74504497 missense probably damaging 1.00
R3894:Slco3a1 UTSW 7 74284613 missense probably damaging 1.00
R4151:Slco3a1 UTSW 7 74359838 missense probably damaging 1.00
R4175:Slco3a1 UTSW 7 74318554 missense probably damaging 0.97
R4303:Slco3a1 UTSW 7 74554528 missense probably benign 0.03
R4462:Slco3a1 UTSW 7 74554563 missense probably benign 0.18
R4702:Slco3a1 UTSW 7 74320567 missense probably damaging 0.98
R4896:Slco3a1 UTSW 7 74320556 missense probably null 1.00
R5419:Slco3a1 UTSW 7 74284615 missense possibly damaging 0.77
R5561:Slco3a1 UTSW 7 74318499 missense possibly damaging 0.67
R5597:Slco3a1 UTSW 7 74284462 missense probably benign 0.31
R5698:Slco3a1 UTSW 7 74346818 missense probably damaging 1.00
R6086:Slco3a1 UTSW 7 74318590 missense possibly damaging 0.64
R6117:Slco3a1 UTSW 7 74318506 missense probably benign 0.02
R6118:Slco3a1 UTSW 7 74318506 missense probably benign 0.02
R6123:Slco3a1 UTSW 7 74318506 missense probably benign 0.02
R6124:Slco3a1 UTSW 7 74318506 missense probably benign 0.02
R6125:Slco3a1 UTSW 7 74318506 missense probably benign 0.02
R7147:Slco3a1 UTSW 7 74504294 missense probably damaging 1.00
R7335:Slco3a1 UTSW 7 74284342 missense probably damaging 0.99
X0017:Slco3a1 UTSW 7 74284360 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TCCATCTAGTGTCTTAGAGGTCC -3'
(R):5'- TGTCACCAGTGTTAGCCCTG -3'

Sequencing Primer
(F):5'- TTTGACTCAGCAAAGGCCTG -3'
(R):5'- TGTTAGCCCTGCTTCTAACAAG -3'
Posted On2019-09-13