Incidental Mutation 'R7335:Nynrin'
ID569451
Institutional Source Beutler Lab
Gene Symbol Nynrin
Ensembl Gene ENSMUSG00000075592
Gene NameNYN domain and retroviral integrase containing
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7335 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location55854010-55874736 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 55863914 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 347 (T347S)
Ref Sequence ENSEMBL: ENSMUSP00000098098 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100529] [ENSMUST00000168479] [ENSMUST00000227465]
Predicted Effect probably benign
Transcript: ENSMUST00000100529
AA Change: T347S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000098098
Gene: ENSMUSG00000075592
AA Change: T347S

DomainStartEndE-ValueType
low complexity region 581 606 N/A INTRINSIC
Pfam:RNase_Zc3h12a 739 890 1.6e-54 PFAM
low complexity region 938 952 N/A INTRINSIC
low complexity region 1212 1228 N/A INTRINSIC
low complexity region 1390 1397 N/A INTRINSIC
PDB:3S3O|B 1478 1706 6e-8 PDB
SCOP:d1cxqa_ 1552 1646 2e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168479
AA Change: T347S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000129557
Gene: ENSMUSG00000075592
AA Change: T347S

DomainStartEndE-ValueType
low complexity region 581 606 N/A INTRINSIC
Pfam:RNase_Zc3h12a 739 890 5.5e-54 PFAM
low complexity region 938 952 N/A INTRINSIC
low complexity region 1212 1228 N/A INTRINSIC
low complexity region 1390 1397 N/A INTRINSIC
PDB:3S3O|B 1478 1706 6e-8 PDB
SCOP:d1cxqa_ 1552 1646 2e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000227465
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts2 A G 11: 50,602,266 S35G probably benign Het
Adcy6 G T 15: 98,603,876 Q286K probably benign Het
Agrn A G 4: 156,176,532 S676P probably damaging Het
Arntl2 A G 6: 146,809,719 M74V probably benign Het
C1rb A T 6: 124,575,279 I319F possibly damaging Het
C2cd3 T C 7: 100,422,603 V629A Het
Cacna1i T G 15: 80,375,575 F1287C probably damaging Het
Catspere2 A G 1: 178,098,508 I247V probably benign Het
Cd101 C G 3: 101,018,729 A229P probably benign Het
Cdh23 T C 10: 60,305,116 D3151G probably damaging Het
Cenpc1 C A 5: 86,034,353 K557N possibly damaging Het
Col6a4 G A 9: 106,076,892 T416M possibly damaging Het
Cyp2c67 A T 19: 39,640,007 C164* probably null Het
Dopey2 A G 16: 93,747,508 E179G probably benign Het
Duoxa2 A T 2: 122,301,340 Y170F possibly damaging Het
Fras1 A G 5: 96,736,970 K2569R possibly damaging Het
Fsip2 C A 2: 82,983,118 H3260Q probably benign Het
Gm3402 T C 5: 146,515,233 I121T probably benign Het
Herc3 T A 6: 58,876,788 H606Q possibly damaging Het
Hmcn2 T C 2: 31,392,157 V1927A possibly damaging Het
Hnf4g A G 3: 3,652,864 H347R possibly damaging Het
Hs3st3a1 A G 11: 64,520,337 T234A probably benign Het
Hyal1 G T 9: 107,579,160 V379L probably benign Het
Ighv1-19 A G 12: 114,708,951 probably benign Het
Iqcc T A 4: 129,616,708 Q338L not run Het
Kdm5b T C 1: 134,560,439 V34A probably damaging Het
Lgals4 T C 7: 28,841,146 F225L probably benign Het
Lmtk3 C T 7: 45,795,157 T1088I unknown Het
Magel2 A T 7: 62,380,776 S1143C unknown Het
Mapk4 A T 18: 73,937,267 L185Q possibly damaging Het
Ncam1 A G 9: 49,506,911 S1030P Het
Pak7 T C 2: 136,098,299 T532A probably damaging Het
Pcdhb15 A G 18: 37,474,336 E207G probably damaging Het
Pde6h T C 6: 136,963,213 W66R probably damaging Het
Pmaip1 T C 18: 66,458,814 probably null Het
Prkd3 A G 17: 78,954,566 F774S probably damaging Het
Prox1 T A 1: 190,161,845 R134S possibly damaging Het
Ptpn22 T A 3: 103,886,019 H495Q probably damaging Het
Ptprj G T 2: 90,440,782 Q1201K probably benign Het
Rp1l1 A G 14: 64,031,998 S1678G probably benign Het
Sgcg T A 14: 61,240,367 Y91F probably damaging Het
Skint2 C T 4: 112,624,218 L93F probably damaging Het
Slc22a22 A T 15: 57,263,375 D99E probably benign Het
Slco3a1 A G 7: 74,284,342 I694T probably damaging Het
Smurf2 A T 11: 106,846,085 I305N possibly damaging Het
Soga1 T C 2: 157,031,005 Q862R possibly damaging Het
Stac3 T A 10: 127,504,900 V178D probably benign Het
Suclg2 T A 6: 95,566,460 N330I probably damaging Het
Suclg2 G A 6: 95,566,463 A329V probably damaging Het
Tas2r118 C T 6: 23,969,750 C104Y probably damaging Het
Tom1l2 T G 11: 60,245,165 E327D probably benign Het
Trit1 T C 4: 123,016,779 M57T possibly damaging Het
Vav1 G A 17: 57,296,720 S134N probably benign Het
Vmn2r82 T C 10: 79,378,888 L235P probably damaging Het
Zfp735 T A 11: 73,711,553 V441E possibly damaging Het
Other mutations in Nynrin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Nynrin APN 14 55868448 missense probably benign 0.38
IGL01131:Nynrin APN 14 55872685 missense probably damaging 1.00
IGL01357:Nynrin APN 14 55870417 missense probably benign
IGL01537:Nynrin APN 14 55872045 missense possibly damaging 0.87
IGL01583:Nynrin APN 14 55870511 missense probably damaging 1.00
IGL01726:Nynrin APN 14 55864154 missense probably benign
IGL02161:Nynrin APN 14 55863984 missense probably damaging 1.00
IGL02167:Nynrin APN 14 55863335 missense probably damaging 1.00
IGL02247:Nynrin APN 14 55871710 nonsense probably null
IGL02302:Nynrin APN 14 55868505 missense probably benign 0.43
IGL02524:Nynrin APN 14 55871474 missense possibly damaging 0.73
IGL02600:Nynrin APN 14 55863992 missense probably benign 0.38
IGL02639:Nynrin APN 14 55870655 missense probably damaging 1.00
IGL02654:Nynrin APN 14 55863259 missense possibly damaging 0.95
IGL02659:Nynrin APN 14 55866097 unclassified probably benign
IGL02736:Nynrin APN 14 55870909 missense probably damaging 1.00
IGL02949:Nynrin APN 14 55872380 missense probably damaging 0.99
PIT4458001:Nynrin UTSW 14 55863968 missense probably benign 0.39
R0017:Nynrin UTSW 14 55872395 missense probably damaging 1.00
R0078:Nynrin UTSW 14 55863332 missense probably damaging 1.00
R0211:Nynrin UTSW 14 55871798 missense probably benign 0.08
R0211:Nynrin UTSW 14 55871798 missense probably benign 0.08
R0413:Nynrin UTSW 14 55872191 missense possibly damaging 0.90
R0609:Nynrin UTSW 14 55872761 missense probably damaging 1.00
R0626:Nynrin UTSW 14 55868035 missense probably damaging 1.00
R1205:Nynrin UTSW 14 55854189 intron probably benign
R1222:Nynrin UTSW 14 55863541 missense probably benign 0.02
R1385:Nynrin UTSW 14 55864899 missense probably benign 0.00
R1820:Nynrin UTSW 14 55870378 missense possibly damaging 0.95
R1829:Nynrin UTSW 14 55872947 missense possibly damaging 0.50
R1874:Nynrin UTSW 14 55863493 missense probably benign 0.04
R1927:Nynrin UTSW 14 55863592 missense probably benign 0.00
R2233:Nynrin UTSW 14 55872067 missense possibly damaging 0.83
R3018:Nynrin UTSW 14 55863410 missense probably benign 0.00
R3154:Nynrin UTSW 14 55863587 missense possibly damaging 0.46
R3853:Nynrin UTSW 14 55864105 missense probably benign 0.24
R4648:Nynrin UTSW 14 55872894 nonsense probably null
R4722:Nynrin UTSW 14 55854395 missense probably damaging 0.97
R4735:Nynrin UTSW 14 55870168 missense probably benign 0.03
R4736:Nynrin UTSW 14 55863997 missense probably damaging 1.00
R4780:Nynrin UTSW 14 55863263 missense probably damaging 1.00
R4804:Nynrin UTSW 14 55864869 missense probably benign
R4816:Nynrin UTSW 14 55872001 missense probably damaging 1.00
R5307:Nynrin UTSW 14 55863806 missense probably damaging 1.00
R5372:Nynrin UTSW 14 55868491 missense probably benign 0.01
R5432:Nynrin UTSW 14 55864466 missense possibly damaging 0.80
R5800:Nynrin UTSW 14 55870631 missense probably damaging 1.00
R5825:Nynrin UTSW 14 55864226 missense probably benign 0.00
R6149:Nynrin UTSW 14 55854323 missense possibly damaging 0.83
R6244:Nynrin UTSW 14 55868028 missense probably damaging 1.00
R6350:Nynrin UTSW 14 55868076 missense probably benign 0.19
R6379:Nynrin UTSW 14 55870391 missense probably damaging 1.00
R6437:Nynrin UTSW 14 55871770 missense probably benign 0.00
R6501:Nynrin UTSW 14 55863532 missense probably benign
R6702:Nynrin UTSW 14 55864478 missense possibly damaging 0.80
R6703:Nynrin UTSW 14 55864478 missense possibly damaging 0.80
R6907:Nynrin UTSW 14 55863878 missense probably benign 0.20
R6908:Nynrin UTSW 14 55863878 missense probably benign 0.20
R6928:Nynrin UTSW 14 55863878 missense probably benign 0.20
R6934:Nynrin UTSW 14 55863878 missense probably benign 0.20
R6935:Nynrin UTSW 14 55863878 missense probably benign 0.20
R7197:Nynrin UTSW 14 55871923 missense probably benign 0.00
R7204:Nynrin UTSW 14 55872733 missense probably damaging 1.00
R7272:Nynrin UTSW 14 55870415 missense probably damaging 1.00
R7361:Nynrin UTSW 14 55870400 missense possibly damaging 0.71
R7368:Nynrin UTSW 14 55870511 missense probably damaging 1.00
R7443:Nynrin UTSW 14 55871416 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- TGGACTTTCTCTAGGGACCAG -3'
(R):5'- TCCAGCTTTAAGGGCAAAGG -3'

Sequencing Primer
(F):5'- CTTTCTCTAGGGACCAGTCTAACAAG -3'
(R):5'- CTTTAAGGGCAAAGGATTCCGTC -3'
Posted On2019-09-13