Incidental Mutation 'R7336:Cep350'
ID569466
Institutional Source Beutler Lab
Gene Symbol Cep350
Ensembl Gene ENSMUSG00000033671
Gene Namecentrosomal protein 350
Synonyms6430546F08Rik, 4933409L06Rik
Accession Numbers

Genbank: NM_001039184.1; Ensembl: ENSMUST00000138762, ENSMUST00000124495, ENSMUST00000078888

Is this an essential gene? Probably essential (E-score: 0.959) question?
Stock #R7336 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location155844964-155973255 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 155862276 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 2607 (H2607L)
Ref Sequence ENSEMBL: ENSMUSP00000120085 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000138762]
Predicted Effect probably benign
Transcript: ENSMUST00000129865
Predicted Effect probably benign
Transcript: ENSMUST00000138762
AA Change: H2607L

PolyPhen 2 Score 0.173 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000120085
Gene: ENSMUSG00000033671
AA Change: H2607L

DomainStartEndE-ValueType
low complexity region 251 265 N/A INTRINSIC
low complexity region 376 394 N/A INTRINSIC
low complexity region 481 491 N/A INTRINSIC
coiled coil region 596 641 N/A INTRINSIC
low complexity region 659 669 N/A INTRINSIC
low complexity region 701 719 N/A INTRINSIC
low complexity region 754 763 N/A INTRINSIC
low complexity region 979 994 N/A INTRINSIC
low complexity region 1153 1175 N/A INTRINSIC
low complexity region 1250 1267 N/A INTRINSIC
coiled coil region 1363 1402 N/A INTRINSIC
low complexity region 1517 1531 N/A INTRINSIC
low complexity region 1536 1546 N/A INTRINSIC
low complexity region 1694 1714 N/A INTRINSIC
coiled coil region 1732 1794 N/A INTRINSIC
low complexity region 1800 1811 N/A INTRINSIC
low complexity region 1819 1835 N/A INTRINSIC
coiled coil region 1853 1893 N/A INTRINSIC
low complexity region 1980 1994 N/A INTRINSIC
coiled coil region 2042 2092 N/A INTRINSIC
low complexity region 2383 2394 N/A INTRINSIC
low complexity region 2409 2421 N/A INTRINSIC
low complexity region 2470 2482 N/A INTRINSIC
CAP_GLY 2486 2551 5.91e-31 SMART
coiled coil region 2700 2731 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a large protein with a CAP-Gly domain typically found in cytoskeleton-associated proteins. The encoded protein primarily localizes to the centrosome, a non-membraneous organelle that functions as the major microtubule-organizing center in animal cells. The encoded protein directly interacts with another large centrosomal protein and is required to anchor microtubules at the centrosome. It is also implicated in the regulation of a class of nuclear hormone receptors in the nucleus. Several alternatively spliced transcript variants have been found, but their full-length nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI

 All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A T 7: 120,388,233 Q1247H possibly damaging Het
Acsf2 G C 11: 94,571,650 Q180E probably benign Het
Adamts8 A G 9: 30,962,067 D856G probably benign Het
Agrn A T 4: 156,174,914 C828* probably null Het
Ankub1 T C 3: 57,665,687 T205A probably benign Het
Atm A T 9: 53,462,503 Y2150N possibly damaging Het
Barhl1 A G 2: 28,909,843 F257L probably benign Het
Bcat2 T A 7: 45,575,485 C27S probably benign Het
Bod1l G A 5: 41,821,524 R816C probably damaging Het
Btg3 A G 16: 78,364,807 Y172H probably benign Het
C130079G13Rik G A 3: 59,932,753 probably null Het
Cacna1d T C 14: 30,045,282 D1940G probably benign Het
Catsperg2 T A 7: 29,706,601 N624I possibly damaging Het
Ccdc146 A G 5: 21,303,112 V646A probably benign Het
Ccp110 C T 7: 118,722,210 P363S probably damaging Het
Cct4 C A 11: 23,001,564 T377K possibly damaging Het
Cfap46 A G 7: 139,620,104 F1954L unknown Het
Chat C T 14: 32,423,256 probably null Het
Clasp2 A G 9: 113,876,353 probably null Het
Cldn9 T C 17: 23,683,015 D212G probably benign Het
Cp G A 3: 19,964,532 probably null Het
Cyfip1 T A 7: 55,926,400 I1108N possibly damaging Het
Dnah14 A G 1: 181,797,734 D4060G probably damaging Het
Dpyd A G 3: 119,064,921 T595A probably damaging Het
Eps8 G A 6: 137,509,213 R434C possibly damaging Het
Fasl A G 1: 161,787,988 Y100H probably damaging Het
Fkbp9 A T 6: 56,849,727 N104I probably damaging Het
Frmd4a A G 2: 4,473,214 T65A possibly damaging Het
Gm1110 T C 9: 26,914,357 N102S probably damaging Het
Gm2381 T C 7: 42,822,380 Q25R possibly damaging Het
Gtpbp2 A G 17: 46,161,313 Y58C probably damaging Het
H2-T3 C A 17: 36,187,345 K269N probably damaging Het
Icosl C A 10: 78,073,873 Y217* probably null Het
Il17rd G T 14: 27,087,546 R153L probably benign Het
Kif17 C A 4: 138,298,306 T973K possibly damaging Het
Klk1b16 A G 7: 44,141,483 I236M probably benign Het
Lgmn G A 12: 102,423,739 probably benign Het
Lmbr1l T C 15: 98,913,587 D54G possibly damaging Het
Lrrc49 A T 9: 60,677,191 I196N possibly damaging Het
Maml1 C T 11: 50,266,449 A300T possibly damaging Het
Mapkap1 A T 2: 34,533,817 Q293L possibly damaging Het
Mki67 T C 7: 135,713,839 T69A probably benign Het
Mlph G A 1: 90,921,983 probably null Het
Myh1 A T 11: 67,220,609 M1625L probably benign Het
Myh3 G T 11: 67,091,021 R781L probably benign Het
Nckap5 A T 1: 126,026,049 I922K probably benign Het
Nlrp5 T A 7: 23,417,634 M261K probably damaging Het
Olfr1317 A T 2: 112,142,169 S75C possibly damaging Het
Olfr312 T A 11: 58,831,924 Y257N probably damaging Het
Olfr396-ps1 G A 11: 73,928,837 M204I probably benign Het
Olfr965 A G 9: 39,719,610 N128D probably benign Het
Pak1 T A 7: 97,888,972 V262E probably benign Het
Pigw A T 11: 84,877,104 D466E probably damaging Het
Pira2 A T 7: 3,844,345 L115Q probably damaging Het
Rbm15 A C 3: 107,333,116 probably benign Het
Rfx1 A G 8: 84,073,756 probably benign Het
Rfx7 A G 9: 72,593,357 Y133C probably damaging Het
Serpinb9d T A 13: 33,200,719 D226E probably benign Het
Sgk3 G A 1: 9,884,476 A271T possibly damaging Het
Sh2d5 T A 4: 138,256,839 C173S probably benign Het
Skint8 T C 4: 111,939,572 V291A probably benign Het
Slc22a27 T A 19: 7,926,689 N28Y probably benign Het
Slc25a54 G A 3: 109,116,435 V449I probably benign Het
Slc39a9 T C 12: 80,679,542 F255S probably damaging Het
Spata31d1c C T 13: 65,036,128 H495Y probably damaging Het
Stab2 G A 10: 86,969,185 Q310* probably null Het
Supt16 C A 14: 52,171,491 A809S possibly damaging Het
Tenm3 A T 8: 48,236,177 M2125K possibly damaging Het
Tex2 G A 11: 106,548,859 T565M unknown Het
Tll1 G A 8: 64,025,142 A859V probably damaging Het
Tmem106c C T 15: 97,969,631 T232I possibly damaging Het
Tmem2 C A 19: 21,826,145 Y847* probably null Het
Trim65 T G 11: 116,128,290 D141A probably benign Het
Trim80 T C 11: 115,441,216 F78S probably damaging Het
Txnrd1 T A 10: 82,873,217 I83N probably benign Het
Vnn3 G A 10: 23,851,908 G72D probably benign Het
Wasl G T 6: 24,619,687 P278Q unknown Het
Wdr62 A T 7: 30,243,917 L951Q probably damaging Het
Zfp760 C T 17: 21,723,833 T663I unknown Het
Other mutations in Cep350
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00764:Cep350 APN 1 155940746 missense possibly damaging 0.68
IGL00821:Cep350 APN 1 155862204 missense probably benign
IGL00837:Cep350 APN 1 155953391 missense probably damaging 1.00
IGL00977:Cep350 APN 1 155932865 missense probably null 0.99
IGL01544:Cep350 APN 1 155953187 missense probably damaging 1.00
IGL01616:Cep350 APN 1 155953247 missense probably benign 0.00
IGL01695:Cep350 APN 1 155944158 missense probably damaging 1.00
IGL01902:Cep350 APN 1 155861985 missense probably damaging 1.00
IGL01977:Cep350 APN 1 155911968 missense probably benign 0.01
IGL02388:Cep350 APN 1 155953753 missense probably benign 0.28
IGL02475:Cep350 APN 1 155862595 missense probably damaging 1.00
IGL02528:Cep350 APN 1 155894615 missense probably damaging 1.00
IGL02598:Cep350 APN 1 155862967 missense probably benign 0.00
IGL02676:Cep350 APN 1 155862231 missense possibly damaging 0.82
IGL02728:Cep350 APN 1 155953222 missense probably benign 0.02
IGL02744:Cep350 APN 1 155931533 missense probably damaging 0.98
IGL02817:Cep350 APN 1 155928842 missense probably damaging 1.00
IGL02892:Cep350 APN 1 155868806 missense possibly damaging 0.51
IGL03156:Cep350 APN 1 155858042 missense probably damaging 1.00
IGL03166:Cep350 APN 1 155863600 missense possibly damaging 0.78
IGL03216:Cep350 APN 1 155860627 missense probably benign 0.06
IGL03268:Cep350 APN 1 155953549 missense probably benign 0.16
IGL03358:Cep350 APN 1 155928539 missense probably benign
NA:Cep350 UTSW 1 155958648 missense probably damaging 1.00
R0060:Cep350 UTSW 1 155928626 missense probably damaging 1.00
R0060:Cep350 UTSW 1 155928626 missense probably damaging 1.00
R0066:Cep350 UTSW 1 155911218 missense probably damaging 0.99
R0066:Cep350 UTSW 1 155911218 missense probably damaging 0.99
R0172:Cep350 UTSW 1 155953447 missense probably benign 0.00
R0365:Cep350 UTSW 1 155906571 missense probably benign 0.00
R0472:Cep350 UTSW 1 155914723 missense probably damaging 0.99
R0502:Cep350 UTSW 1 155900883 splice site probably null
R0538:Cep350 UTSW 1 155848620 missense possibly damaging 0.80
R0547:Cep350 UTSW 1 155901435 splice site probably null
R0565:Cep350 UTSW 1 155961195 splice site probably benign
R0607:Cep350 UTSW 1 155872048 missense probably damaging 1.00
R0645:Cep350 UTSW 1 155940712 splice site probably null
R0675:Cep350 UTSW 1 155959753 missense possibly damaging 0.63
R0828:Cep350 UTSW 1 155953246 missense probably benign 0.00
R0863:Cep350 UTSW 1 155862235 missense probably benign 0.00
R0969:Cep350 UTSW 1 155940826 missense possibly damaging 0.81
R1102:Cep350 UTSW 1 155931518 missense probably damaging 1.00
R1186:Cep350 UTSW 1 155875376 missense probably damaging 1.00
R1552:Cep350 UTSW 1 155910738 missense possibly damaging 0.92
R1560:Cep350 UTSW 1 155929079 missense possibly damaging 0.48
R1698:Cep350 UTSW 1 155953358 missense possibly damaging 0.62
R1729:Cep350 UTSW 1 155911981 missense probably benign 0.17
R1735:Cep350 UTSW 1 155953214 missense probably damaging 0.99
R1740:Cep350 UTSW 1 155928833 missense probably damaging 1.00
R1783:Cep350 UTSW 1 155928865 missense probably damaging 1.00
R1844:Cep350 UTSW 1 155848628 missense probably damaging 0.99
R1848:Cep350 UTSW 1 155953651 missense probably benign 0.28
R1988:Cep350 UTSW 1 155933104 missense possibly damaging 0.82
R2008:Cep350 UTSW 1 155914721 missense probably benign 0.16
R2241:Cep350 UTSW 1 155958556 splice site probably null
R2245:Cep350 UTSW 1 155879020 missense probably benign 0.10
R2402:Cep350 UTSW 1 155863136 missense probably benign
R2566:Cep350 UTSW 1 155959718 critical splice donor site probably null
R3160:Cep350 UTSW 1 155863164 missense probably benign 0.00
R3162:Cep350 UTSW 1 155863164 missense probably benign 0.00
R3769:Cep350 UTSW 1 155953204 missense probably damaging 1.00
R4035:Cep350 UTSW 1 155959795 missense probably benign 0.06
R4158:Cep350 UTSW 1 155932875 missense probably damaging 1.00
R4160:Cep350 UTSW 1 155932875 missense probably damaging 1.00
R4213:Cep350 UTSW 1 155935961 missense probably damaging 1.00
R4483:Cep350 UTSW 1 155926468 missense probably benign 0.01
R4648:Cep350 UTSW 1 155902598 missense possibly damaging 0.85
R4694:Cep350 UTSW 1 155928586 missense probably damaging 1.00
R4836:Cep350 UTSW 1 155928833 missense probably damaging 1.00
R4839:Cep350 UTSW 1 155928494 missense probably benign 0.00
R4969:Cep350 UTSW 1 155860279 missense probably damaging 0.99
R5014:Cep350 UTSW 1 155928206 missense probably benign 0.00
R5027:Cep350 UTSW 1 155933354 missense probably benign 0.01
R5144:Cep350 UTSW 1 155911150 missense probably damaging 0.99
R5153:Cep350 UTSW 1 155935946 missense probably damaging 1.00
R5165:Cep350 UTSW 1 155928368 missense probably damaging 1.00
R5182:Cep350 UTSW 1 155858108 missense probably damaging 1.00
R5445:Cep350 UTSW 1 155894723 missense probably benign 0.01
R5738:Cep350 UTSW 1 155866078 missense probably damaging 1.00
R5809:Cep350 UTSW 1 155933341 missense probably damaging 0.98
R5855:Cep350 UTSW 1 155953762 missense probably benign 0.00
R6103:Cep350 UTSW 1 155924576 missense probably benign 0.05
R6139:Cep350 UTSW 1 155953279 missense probably benign 0.03
R6285:Cep350 UTSW 1 155953374 missense possibly damaging 0.48
R6430:Cep350 UTSW 1 155894673 missense probably damaging 1.00
R6446:Cep350 UTSW 1 155862154 missense probably benign
R6520:Cep350 UTSW 1 155933336 missense probably benign 0.02
R6712:Cep350 UTSW 1 155858106 missense possibly damaging 0.93
R6940:Cep350 UTSW 1 155928551 missense probably benign 0.01
R7020:Cep350 UTSW 1 155928331 missense probably damaging 1.00
R7056:Cep350 UTSW 1 155848627 missense probably damaging 1.00
R7141:Cep350 UTSW 1 155914748 missense probably damaging 1.00
R7215:Cep350 UTSW 1 155894707 missense possibly damaging 0.89
R7247:Cep350 UTSW 1 155910753 missense probably damaging 1.00
R7272:Cep350 UTSW 1 155953588 missense probably damaging 0.98
R7361:Cep350 UTSW 1 155901491 missense probably damaging 1.00
R7390:Cep350 UTSW 1 155866087 missense possibly damaging 0.94
R7402:Cep350 UTSW 1 155928215 missense probably benign 0.00
R7428:Cep350 UTSW 1 155894619 missense probably benign 0.00
R7440:Cep350 UTSW 1 155940772 missense probably damaging 0.98
X0018:Cep350 UTSW 1 155953286 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- GTTGTCTGAAGTAGCAGCACC -3'
(R):5'- TGTGTGCAAAGACAAGCATG -3'

Sequencing Primer
(F):5'- TGAAGTAGCAGCACCCGCAG -3'
(R):5'- GACAAGCATGGTATTTTTGCTCC -3'
Posted On2019-09-13