Incidental Mutation 'R7338:Cdk11b'
ID569638
Institutional Source Beutler Lab
Gene Symbol Cdk11b
Ensembl Gene ENSMUSG00000029062
Gene Namecyclin-dependent kinase 11B
SynonymsPITSLRE proteins, CDK11-p110, Cdc2l1, Cdc2l2, CDK11-p46, CDK11-p58
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7338 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location155624854-155649938 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 155647551 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 473 (R473G)
Ref Sequence ENSEMBL: ENSMUSP00000070527 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030937] [ENSMUST00000067081] [ENSMUST00000105598] [ENSMUST00000105600] [ENSMUST00000115821]
Predicted Effect probably benign
Transcript: ENSMUST00000030937
SMART Domains Protein: ENSMUSP00000030937
Gene: ENSMUSG00000029061

DomainStartEndE-ValueType
low complexity region 19 41 N/A INTRINSIC
ZnMc 85 256 8.39e-48 SMART
ShKT 255 291 4.06e-10 SMART
IG 307 390 4.53e-2 SMART
Predicted Effect unknown
Transcript: ENSMUST00000067081
AA Change: R473G
SMART Domains Protein: ENSMUSP00000070527
Gene: ENSMUSG00000029062
AA Change: R473G

DomainStartEndE-ValueType
low complexity region 19 48 N/A INTRINSIC
low complexity region 93 112 N/A INTRINSIC
coiled coil region 123 214 N/A INTRINSIC
low complexity region 252 259 N/A INTRINSIC
low complexity region 261 272 N/A INTRINSIC
coiled coil region 290 337 N/A INTRINSIC
low complexity region 369 383 N/A INTRINSIC
S_TKc 427 712 5.05e-93 SMART
Predicted Effect unknown
Transcript: ENSMUST00000105598
AA Change: R439G
SMART Domains Protein: ENSMUSP00000101223
Gene: ENSMUSG00000029062
AA Change: R439G

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 59 78 N/A INTRINSIC
coiled coil region 89 180 N/A INTRINSIC
low complexity region 218 225 N/A INTRINSIC
low complexity region 227 238 N/A INTRINSIC
coiled coil region 256 303 N/A INTRINSIC
low complexity region 335 349 N/A INTRINSIC
S_TKc 393 678 5.05e-93 SMART
Predicted Effect unknown
Transcript: ENSMUST00000105600
AA Change: R473G
SMART Domains Protein: ENSMUSP00000101225
Gene: ENSMUSG00000029062
AA Change: R473G

DomainStartEndE-ValueType
low complexity region 19 48 N/A INTRINSIC
low complexity region 93 112 N/A INTRINSIC
coiled coil region 123 214 N/A INTRINSIC
low complexity region 252 259 N/A INTRINSIC
low complexity region 261 272 N/A INTRINSIC
coiled coil region 290 337 N/A INTRINSIC
low complexity region 369 383 N/A INTRINSIC
S_TKc 427 712 5.05e-93 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115821
SMART Domains Protein: ENSMUSP00000111488
Gene: ENSMUSG00000073682

DomainStartEndE-ValueType
SCOP:d1l9ha_ 17 52 2e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serine/threonine protein kinase family. Members of this kinase family are known to be essential for eukaryotic cell cycle control. Due to a segmental duplication, this gene shares very high sequence identity with a neighboring gene. These two genes are frequently deleted or altered in neuroblastoma. The protein kinase encoded by this gene can be cleaved by caspases and may play a role in cell apoptosis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null embryos display embryonic lethality from cell cycle arrest. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T C 17: 24,376,743 S357P possibly damaging Het
Arhgap28 T C 17: 67,896,111 R166G probably damaging Het
Bcan T A 3: 87,994,243 E384V probably damaging Het
Bcl9l A G 9: 44,508,708 N1137S probably benign Het
Caprin1 A G 2: 103,779,423 L170S probably benign Het
Card6 C T 15: 5,099,872 E681K probably benign Het
Catsperb G A 12: 101,480,984 V248I probably benign Het
Ccnj T A 19: 40,837,033 H62Q probably damaging Het
Cd180 A C 13: 102,706,428 I661L probably benign Het
Cep126 T C 9: 8,099,798 T912A possibly damaging Het
Chek2 T A 5: 110,873,514 V530E probably benign Het
Chga G T 12: 102,562,841 S359I probably damaging Het
Cnrip1 T C 11: 17,054,657 V69A probably damaging Het
Cyp2a5 A T 7: 26,842,947 Q458L probably damaging Het
Cyp2j11 T A 4: 96,307,287 T391S possibly damaging Het
Dhx16 T C 17: 35,888,144 L794P probably damaging Het
Dscaml1 A G 9: 45,674,504 T580A probably benign Het
Elmo1 A T 13: 20,280,812 I184L probably benign Het
Gabra1 C T 11: 42,182,294 G51S unknown Het
Gabrr3 C A 16: 59,448,076 L351I possibly damaging Het
Gbp7 A T 3: 142,538,025 N111I probably damaging Het
Gjd2 C T 2: 114,011,102 R298H probably damaging Het
Gm5930 T C 14: 44,336,457 Y141C probably damaging Het
Grin3a G T 4: 49,771,238 N511K probably benign Het
Hdac7 T C 15: 97,810,022 D122G probably benign Het
Ifi204 G A 1: 173,760,137 T152I possibly damaging Het
Med21 T A 6: 146,642,584 probably benign Het
Mmp19 A T 10: 128,799,083 T523S probably benign Het
Nav3 G A 10: 109,769,212 T1000I probably benign Het
Nin T C 12: 70,044,064 D859G Het
Nip7 T G 8: 107,057,284 L52R possibly damaging Het
Olfr1039 A T 2: 86,131,382 F94I probably damaging Het
Olfr524 A T 7: 140,202,533 V79E probably benign Het
Olfr934 A G 9: 38,982,520 Y175H probably damaging Het
Otop1 T A 5: 38,300,203 Y435* probably null Het
Pak4 A G 7: 28,564,956 S174P probably benign Het
Pcsk7 G A 9: 45,925,989 R537Q probably benign Het
Podxl G A 6: 31,529,006 S34F unknown Het
Prr36 G A 8: 4,216,212 R113C probably damaging Het
Ptk7 T C 17: 46,579,599 I436V probably benign Het
Slc13a5 C T 11: 72,266,484 V28I probably benign Het
Slc9a3r2 T A 17: 24,650,208 probably benign Het
Slco6d1 A T 1: 98,421,372 D56V probably benign Het
Spg11 G A 2: 122,055,377 R2317W probably damaging Het
Stom T A 2: 35,323,748 probably null Het
Svs5 T C 2: 164,332,808 L8P possibly damaging Het
Tmem141 C A 2: 25,621,614 V39F probably damaging Het
Tmprss6 A G 15: 78,459,819 L181P probably damaging Het
Tnni3 A G 7: 4,521,380 S40P probably benign Het
Tubgcp4 A G 2: 121,193,984 I548V probably benign Het
Wrap73 A G 4: 154,152,586 D210G probably benign Het
Yipf4 T G 17: 74,489,776 S21A probably benign Het
Zscan20 A G 4: 128,588,150 M573T probably benign Het
Other mutations in Cdk11b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01764:Cdk11b APN 4 155628803 missense possibly damaging 0.54
R0071:Cdk11b UTSW 4 155649423 unclassified probably benign
R0071:Cdk11b UTSW 4 155649423 unclassified probably benign
R0145:Cdk11b UTSW 4 155641619 intron probably benign
R0372:Cdk11b UTSW 4 155641500 intron probably benign
R0426:Cdk11b UTSW 4 155642512 intron probably benign
R0471:Cdk11b UTSW 4 155647542 unclassified probably benign
R0627:Cdk11b UTSW 4 155640772 intron probably benign
R1475:Cdk11b UTSW 4 155634217 missense probably damaging 1.00
R1611:Cdk11b UTSW 4 155641575 intron probably benign
R1719:Cdk11b UTSW 4 155648397 unclassified probably benign
R1750:Cdk11b UTSW 4 155628680 intron probably null
R2061:Cdk11b UTSW 4 155641604 intron probably benign
R2274:Cdk11b UTSW 4 155647594 unclassified probably benign
R2922:Cdk11b UTSW 4 155640744 intron probably benign
R3719:Cdk11b UTSW 4 155626886 missense probably damaging 1.00
R3917:Cdk11b UTSW 4 155626801 missense probably damaging 1.00
R4077:Cdk11b UTSW 4 155639747 intron probably benign
R4078:Cdk11b UTSW 4 155639747 intron probably benign
R5033:Cdk11b UTSW 4 155648825 unclassified probably benign
R5212:Cdk11b UTSW 4 155638615 intron probably null
R5556:Cdk11b UTSW 4 155634147 nonsense probably null
R5622:Cdk11b UTSW 4 155630217 missense probably damaging 1.00
R5927:Cdk11b UTSW 4 155648240 unclassified probably benign
R5975:Cdk11b UTSW 4 155648240 unclassified probably benign
R6276:Cdk11b UTSW 4 155634190 missense probably benign 0.11
R6278:Cdk11b UTSW 4 155649603 unclassified probably benign
R6905:Cdk11b UTSW 4 155641608 intron probably benign
R6998:Cdk11b UTSW 4 155648343 nonsense probably null
R7021:Cdk11b UTSW 4 155641567 intron probably benign
R7062:Cdk11b UTSW 4 155626811 missense probably damaging 1.00
R7100:Cdk11b UTSW 4 155625593 missense probably damaging 1.00
Z1088:Cdk11b UTSW 4 155641564 intron probably benign
Predicted Primers PCR Primer
(F):5'- GTCCCAAATGCTGAGATCAAAG -3'
(R):5'- GCTGACCCTAGGATATCATGGAG -3'

Sequencing Primer
(F):5'- TGCTGAGATCAAAGGCATTTGC -3'
(R):5'- AGGATATCATGGAGCCCTCTTAC -3'
Posted On2019-09-13