Incidental Mutation 'R7338:Tnni3'
ID569643
Institutional Source Beutler Lab
Gene Symbol Tnni3
Ensembl Gene ENSMUSG00000035458
Gene Nametroponin I, cardiac 3
SynonymscTnI, cardiac troponin I, Tn1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7338 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location4518305-4524229 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4521380 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 40 (S40P)
Ref Sequence ENSEMBL: ENSMUSP00000096458 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094897] [ENSMUST00000098859] [ENSMUST00000140424] [ENSMUST00000154913] [ENSMUST00000163722] [ENSMUST00000209148]
PDB Structure
Solution structure of the bisphosphorylated cardiac specific N-extension of cardiac troponin I [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000094897
SMART Domains Protein: ENSMUSP00000092498
Gene: ENSMUSG00000055809

DomainStartEndE-ValueType
Pfam:DUF4470 16 122 1.3e-27 PFAM
Pfam:DUF4471 154 436 5.3e-104 PFAM
internal_repeat_1 467 512 1.63e-5 PROSPERO
internal_repeat_1 525 568 1.63e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000098859
AA Change: S40P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000096458
Gene: ENSMUSG00000035458
AA Change: S40P

DomainStartEndE-ValueType
Pfam:Troponin-I_N 1 32 1e-10 PFAM
Pfam:Troponin 47 178 3.6e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140424
AA Change: S40P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000115015
Gene: ENSMUSG00000035458
AA Change: S40P

DomainStartEndE-ValueType
Pfam:Troponin-I_N 1 32 1.1e-14 PFAM
Pfam:Troponin 47 125 3e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154913
AA Change: S40P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000122916
Gene: ENSMUSG00000035458
AA Change: S40P

DomainStartEndE-ValueType
Pfam:Troponin-I_N 1 32 9e-15 PFAM
Pfam:Troponin 47 112 1.8e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163722
SMART Domains Protein: ENSMUSP00000129409
Gene: ENSMUSG00000064179

DomainStartEndE-ValueType
low complexity region 17 64 N/A INTRINSIC
Pfam:Troponin 76 118 1.9e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209148
AA Change: S90P

PolyPhen 2 Score 0.183 (Sensitivity: 0.92; Specificity: 0.87)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Troponin I (TnI), along with troponin T (TnT) and troponin C (TnC), is one of 3 subunits that form the troponin complex of the thin filaments of striated muscle. TnI is the inhibitory subunit; blocking actin-myosin interactions and thereby mediating striated muscle relaxation. The TnI subfamily contains three genes: TnI-skeletal-fast-twitch, TnI-skeletal-slow-twitch, and TnI-cardiac. This gene encodes the TnI-cardiac protein and is exclusively expressed in cardiac muscle tissues. Mutations in this gene cause familial hypertrophic cardiomyopathy type 7 (CMH7) and familial restrictive cardiomyopathy (RCM). [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice lacking both functional copies of this gene die of acute heart failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T C 17: 24,376,743 S357P possibly damaging Het
Arhgap28 T C 17: 67,896,111 R166G probably damaging Het
Bcan T A 3: 87,994,243 E384V probably damaging Het
Bcl9l A G 9: 44,508,708 N1137S probably benign Het
Caprin1 A G 2: 103,779,423 L170S probably benign Het
Card6 C T 15: 5,099,872 E681K probably benign Het
Catsperb G A 12: 101,480,984 V248I probably benign Het
Ccnj T A 19: 40,837,033 H62Q probably damaging Het
Cd180 A C 13: 102,706,428 I661L probably benign Het
Cdk11b A G 4: 155,647,551 R473G unknown Het
Cep126 T C 9: 8,099,798 T912A possibly damaging Het
Chek2 T A 5: 110,873,514 V530E probably benign Het
Chga G T 12: 102,562,841 S359I probably damaging Het
Cnrip1 T C 11: 17,054,657 V69A probably damaging Het
Cyp2a5 A T 7: 26,842,947 Q458L probably damaging Het
Cyp2j11 T A 4: 96,307,287 T391S possibly damaging Het
Dhx16 T C 17: 35,888,144 L794P probably damaging Het
Dscaml1 A G 9: 45,674,504 T580A probably benign Het
Elmo1 A T 13: 20,280,812 I184L probably benign Het
Gabra1 C T 11: 42,182,294 G51S unknown Het
Gabrr3 C A 16: 59,448,076 L351I possibly damaging Het
Gbp7 A T 3: 142,538,025 N111I probably damaging Het
Gjd2 C T 2: 114,011,102 R298H probably damaging Het
Gm5930 T C 14: 44,336,457 Y141C probably damaging Het
Grin3a G T 4: 49,771,238 N511K probably benign Het
Hdac7 T C 15: 97,810,022 D122G probably benign Het
Ifi204 G A 1: 173,760,137 T152I possibly damaging Het
Med21 T A 6: 146,642,584 probably benign Het
Mmp19 A T 10: 128,799,083 T523S probably benign Het
Nav3 G A 10: 109,769,212 T1000I probably benign Het
Nin T C 12: 70,044,064 D859G Het
Nip7 T G 8: 107,057,284 L52R possibly damaging Het
Olfr1039 A T 2: 86,131,382 F94I probably damaging Het
Olfr524 A T 7: 140,202,533 V79E probably benign Het
Olfr934 A G 9: 38,982,520 Y175H probably damaging Het
Otop1 T A 5: 38,300,203 Y435* probably null Het
Pak4 A G 7: 28,564,956 S174P probably benign Het
Pcsk7 G A 9: 45,925,989 R537Q probably benign Het
Podxl G A 6: 31,529,006 S34F unknown Het
Prr36 G A 8: 4,216,212 R113C probably damaging Het
Ptk7 T C 17: 46,579,599 I436V probably benign Het
Slc13a5 C T 11: 72,266,484 V28I probably benign Het
Slc9a3r2 T A 17: 24,650,208 probably benign Het
Slco6d1 A T 1: 98,421,372 D56V probably benign Het
Spg11 G A 2: 122,055,377 R2317W probably damaging Het
Stom T A 2: 35,323,748 probably null Het
Svs5 T C 2: 164,332,808 L8P possibly damaging Het
Tmem141 C A 2: 25,621,614 V39F probably damaging Het
Tmprss6 A G 15: 78,459,819 L181P probably damaging Het
Tubgcp4 A G 2: 121,193,984 I548V probably benign Het
Wrap73 A G 4: 154,152,586 D210G probably benign Het
Yipf4 T G 17: 74,489,776 S21A probably benign Het
Zscan20 A G 4: 128,588,150 M573T probably benign Het
Other mutations in Tnni3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1589:Tnni3 UTSW 7 4520526 missense probably damaging 1.00
R2259:Tnni3 UTSW 7 4519406 missense probably benign 0.11
R5696:Tnni3 UTSW 7 4520454 missense probably benign 0.03
R5954:Tnni3 UTSW 7 4519540 missense probably damaging 1.00
R6973:Tnni3 UTSW 7 4518417 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CAAAACCTGCCTCGTTTCTG -3'
(R):5'- ACAGCAAGGTTTAGGCGTG -3'

Sequencing Primer
(F):5'- CCTCGTTTCTGCCCGCG -3'
(R):5'- TTAGCAGTGAATAGATAGGCAGTGC -3'
Posted On2019-09-13