Incidental Mutation 'R7339:Olfr503'
ID569707
Institutional Source Beutler Lab
Gene Symbol Olfr503
Ensembl Gene ENSMUSG00000060759
Gene Nameolfactory receptor 503
SynonymsGA_x6K02T2PBJ9-10874315-10875286, Olfr1548, MOR34-8P, MOR34-9, MOR34-9, MOR34-12
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R7339 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location108544527-108545498 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 108544900 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 125 (D125A)
Ref Sequence ENSEMBL: ENSMUSP00000077296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078162] [ENSMUST00000211693]
Predicted Effect probably damaging
Transcript: ENSMUST00000078162
AA Change: D125A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077296
Gene: ENSMUSG00000060759
AA Change: D125A

DomainStartEndE-ValueType
Pfam:7tm_4 35 315 3e-103 PFAM
Pfam:7TM_GPCR_Srsx 39 268 2.4e-7 PFAM
Pfam:7tm_1 45 297 9.2e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000211693
AA Change: D123A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik G A 11: 78,272,384 probably null Het
2900026A02Rik T C 5: 113,183,072 D1092G probably benign Het
9030624J02Rik A T 7: 118,809,971 I612F probably damaging Het
Abcb11 C T 2: 69,299,867 D282N probably damaging Het
Ahnak A T 19: 9,008,165 N2271I possibly damaging Het
Amz1 A G 5: 140,741,551 S90G probably benign Het
Arhgap5 A G 12: 52,517,698 E484G possibly damaging Het
Arid3c A G 4: 41,729,883 probably null Het
Atp1a1 T C 3: 101,589,872 I373V probably benign Het
Barhl1 T C 2: 28,909,887 E242G probably damaging Het
Cactin CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG 10: 81,321,318 probably benign Het
Casz1 T A 4: 148,951,745 V1488E probably damaging Het
Ccdc175 C A 12: 72,136,041 Q401H probably damaging Het
Cfap36 T C 11: 29,225,925 Y191C probably benign Het
Chmp2b G A 16: 65,545,346 Q119* probably null Het
Cps1 T A 1: 67,197,015 I969N possibly damaging Het
Dennd5a A G 7: 109,901,159 F920L probably damaging Het
Dnah12 A T 14: 26,872,320 T3410S probably benign Het
Fbxo42 T G 4: 141,200,144 S578R possibly damaging Het
Fcgr1 C T 3: 96,284,299 G398R not run Het
Foxa3 A T 7: 19,014,869 Y111N probably damaging Het
Gabbr2 T C 4: 46,846,340 K190E probably benign Het
Gbp10 T C 5: 105,220,098 Y403C possibly damaging Het
Gm906 A T 13: 50,247,168 I374N possibly damaging Het
Hsd3b5 A G 3: 98,622,074 I80T probably damaging Het
Kri1 T G 9: 21,286,587 Q89P Het
Mkrn3 C T 7: 62,419,782 R87H probably benign Het
Ms4a6d G A 19: 11,590,073 Q155* probably null Het
Naip6 G T 13: 100,316,019 P178Q probably damaging Het
Ncapg2 A G 12: 116,414,834 E160G probably damaging Het
Nek6 G A 2: 38,560,965 A127T probably damaging Het
Nell1 T C 7: 50,279,549 V264A probably benign Het
Nlrp2 T A 7: 5,327,628 I590F possibly damaging Het
Olfr1308 A T 2: 111,960,611 M154K probably benign Het
Olfr1310 A G 2: 112,008,475 L237P probably damaging Het
Olfr1390 G A 11: 49,341,048 R172Q not run Het
Olfr71 C T 4: 43,706,080 A163T probably benign Het
Otop3 T A 11: 115,346,378 L556Q probably damaging Het
Padi1 T C 4: 140,829,234 D190G probably null Het
Pald1 T C 10: 61,323,331 S774G possibly damaging Het
Pde10a C T 17: 8,757,028 T55I probably benign Het
Pla2g4d T C 2: 120,278,978 M197V probably benign Het
Prom1 C A 5: 44,101,653 probably benign Het
Ptdss1 A G 13: 66,963,362 H164R possibly damaging Het
Rrh A T 3: 129,810,613 I313N probably damaging Het
Slc35b4 A G 6: 34,167,656 I88T probably damaging Het
Slc38a11 C T 2: 65,326,570 V353I probably benign Het
Spdef T A 17: 27,720,245 E42D probably benign Het
Tgoln1 G C 6: 72,616,278 T73R probably benign Het
Tmx1 A G 12: 70,458,850 D129G probably benign Het
Trav13n-4 A T 14: 53,363,978 Y68F probably benign Het
Trp53 T C 11: 69,589,189 S238P probably damaging Het
Trp53bp1 T C 2: 121,236,469 D592G probably benign Het
Ttll5 T C 12: 85,857,464 probably null Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Vmn2r43 A T 7: 8,255,307 Y302* probably null Het
Vps13d C T 4: 145,121,368 V2478I Het
Wsb1 A G 11: 79,240,358 V404A probably damaging Het
Zfc3h1 A G 10: 115,403,300 D539G probably damaging Het
Zfp318 T C 17: 46,411,247 V1392A probably damaging Het
Other mutations in Olfr503
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Olfr503 APN 7 108544726 nonsense probably null
IGL02031:Olfr503 APN 7 108544930 missense probably benign 0.03
IGL02426:Olfr503 APN 7 108544980 missense probably benign 0.01
IGL02502:Olfr503 APN 7 108544639 missense probably damaging 1.00
IGL03208:Olfr503 APN 7 108545119 missense probably benign 0.02
R0507:Olfr503 UTSW 7 108545085 missense probably damaging 0.98
R0967:Olfr503 UTSW 7 108544789 missense probably damaging 1.00
R1181:Olfr503 UTSW 7 108545302 missense probably benign 0.00
R1501:Olfr503 UTSW 7 108544575 missense probably benign
R1596:Olfr503 UTSW 7 108545083 missense possibly damaging 0.90
R1657:Olfr503 UTSW 7 108545377 missense possibly damaging 0.50
R1708:Olfr503 UTSW 7 108544574 missense probably benign 0.04
R2215:Olfr503 UTSW 7 108544888 missense probably damaging 1.00
R4131:Olfr503 UTSW 7 108544537 nonsense probably null
R4772:Olfr503 UTSW 7 108544885 missense probably damaging 0.98
R5009:Olfr503 UTSW 7 108544848 missense probably benign 0.01
R5297:Olfr503 UTSW 7 108545404 missense probably damaging 1.00
R5788:Olfr503 UTSW 7 108545344 missense probably damaging 0.97
R5944:Olfr503 UTSW 7 108545277 missense possibly damaging 0.90
R6522:Olfr503 UTSW 7 108544995 missense probably benign 0.09
R7045:Olfr503 UTSW 7 108545245 missense probably damaging 1.00
R7558:Olfr503 UTSW 7 108544721 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGATTCCTTACACAGACCCATG -3'
(R):5'- TGGCTACAGACATGTGGTCAC -3'

Sequencing Primer
(F):5'- ACAGACCCATGTACTACTTTTTAGC -3'
(R):5'- ACATGTGGTCACAGTAGGTATG -3'
Posted On2019-09-13