Incidental Mutation 'R0639:Kat2b'
ID56971
Institutional Source Beutler Lab
Gene Symbol Kat2b
Ensembl Gene ENSMUSG00000000708
Gene NameK(lysine) acetyltransferase 2B
SynonymsPcaf, A930006P13Rik
MMRRC Submission 038828-MU
Accession Numbers

Genbank: NM_020005

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0639 (G1)
Quality Score109
Status Not validated
Chromosome17
Chromosomal Location53566861-53672720 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 53567538 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 70 (A70E)
Ref Sequence ENSEMBL: ENSMUSP00000000724 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000724]
Predicted Effect probably benign
Transcript: ENSMUST00000000724
AA Change: A70E

PolyPhen 2 Score 0.380 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000000724
Gene: ENSMUSG00000000708
AA Change: A70E

DomainStartEndE-ValueType
low complexity region 4 21 N/A INTRINSIC
low complexity region 32 55 N/A INTRINSIC
Pfam:PCAF_N 56 308 6.2e-114 PFAM
low complexity region 461 472 N/A INTRINSIC
Pfam:Acetyltransf_7 522 605 1.5e-11 PFAM
Pfam:Acetyltransf_1 530 604 3.2e-11 PFAM
low complexity region 643 659 N/A INTRINSIC
BROMO 702 810 1.08e-44 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163648
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CBP and p300 are large nuclear proteins that bind to many sequence-specific factors involved in cell growth and/or differentiation, including c-jun and the adenoviral oncoprotein E1A. The protein encoded by this gene associates with p300/CBP. It has in vitro and in vivo binding activity with CBP and p300, and competes with E1A for binding sites in p300/CBP. It has histone acetyl transferase activity with core histones and nucleosome core particles, indicating that this protein plays a direct role in transcriptional regulation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit no abrnomal phenotype. [provided by MGI curators]
Allele List at MGI

All alleles(122) : Targeted, knock-out(2) Targeted, other(1) Gene trapped(119)

Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600014C23Rik C T 17: 45,733,073 W86* probably null Het
5830411N06Rik A G 7: 140,247,959 N27D probably benign Het
Acadl T C 1: 66,857,408 H75R probably benign Het
Adamtsl1 T C 4: 86,277,143 F599S probably damaging Het
Adrb3 T C 8: 27,228,265 N52S probably damaging Het
Agbl3 T A 6: 34,799,705 L377Q probably damaging Het
Akap9 T C 5: 4,060,318 L3007P probably damaging Het
Amer3 T A 1: 34,587,821 Y380* probably null Het
Ankrd13d A T 19: 4,273,019 probably null Het
Ap4m1 T A 5: 138,176,239 C235S probably benign Het
Arhgap29 T C 3: 122,007,641 F675S probably damaging Het
Asah2 C A 19: 32,008,639 V544F probably damaging Het
Ash2l A G 8: 25,823,291 I389T possibly damaging Het
Bend5 T C 4: 111,433,298 S164P probably benign Het
Cacna1d A G 14: 30,171,294 probably null Het
Cdc25b A G 2: 131,197,262 N516D probably benign Het
Cdc27 A G 11: 104,531,734 Y125H probably damaging Het
Cdk5r2 C T 1: 74,855,836 L247F probably damaging Het
Cenpf C A 1: 189,658,062 G1191V probably benign Het
Cops4 C T 5: 100,537,460 T293I possibly damaging Het
Csmd3 A G 15: 47,913,940 L1294P probably damaging Het
Dclre1a T C 19: 56,538,440 Y848C probably damaging Het
Disp2 A T 2: 118,790,844 I686F possibly damaging Het
Dnah6 T A 6: 73,022,412 Y4012F probably benign Het
Dnajc11 C G 4: 151,969,936 R200G probably damaging Het
Dnhd1 A T 7: 105,696,464 D2272V possibly damaging Het
Elane A C 10: 79,886,349 R5S possibly damaging Het
Entpd7 G A 19: 43,691,094 V29M probably benign Het
Fanca A G 8: 123,289,359 probably null Het
Fgl1 G T 8: 41,191,624 T281K probably benign Het
Flii T C 11: 60,722,997 probably null Het
Foxn1 T C 11: 78,371,144 D133G possibly damaging Het
Fzd7 T A 1: 59,484,560 M534K probably damaging Het
Galnt5 A G 2: 57,999,395 T336A probably benign Het
Gli3 G A 13: 15,724,715 D896N probably damaging Het
Gsx1 G T 5: 147,189,946 W193L probably damaging Het
Gtpbp3 A T 8: 71,492,735 I485F probably damaging Het
H2-M11 A G 17: 36,547,391 T26A probably benign Het
Igfbp7 T C 5: 77,351,980 D243G probably damaging Het
Il31ra A T 13: 112,525,843 D477E possibly damaging Het
Inmt A C 6: 55,171,227 V139G probably damaging Het
Inpp5j T A 11: 3,501,147 M501L probably benign Het
Itsn2 T C 12: 4,712,556 F1579L probably damaging Het
Klhl20 T C 1: 161,093,711 E58G probably damaging Het
Krt79 A T 15: 101,931,548 Y337* probably null Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Letm1 T C 5: 33,769,426 I176V possibly damaging Het
Lingo3 C A 10: 80,835,784 R104L probably benign Het
Lrig3 T G 10: 126,010,221 C840G probably damaging Het
Lrrc9 A G 12: 72,486,288 N977S probably damaging Het
Lrrk2 T A 15: 91,772,996 M1831K probably benign Het
Mn1 A T 5: 111,419,316 D384V probably damaging Het
Morc3 C A 16: 93,853,850 H319Q probably damaging Het
Morn1 T C 4: 155,089,503 F56L possibly damaging Het
Mrpl53 G T 6: 83,109,411 V64L probably damaging Het
Myo15 T A 11: 60,479,336 V974D probably benign Het
Neb A G 2: 52,256,124 V2947A possibly damaging Het
Nfasc A C 1: 132,603,816 N737K probably damaging Het
Nlk T C 11: 78,572,277 D464G possibly damaging Het
Nlrc4 C T 17: 74,426,963 R985K probably benign Het
Nsun6 T C 2: 14,996,336 K470E probably benign Het
Nup85 T G 11: 115,564,531 M1R probably null Het
Olfr887 G A 9: 38,085,370 C178Y probably damaging Het
Otop1 T C 5: 38,287,948 V150A possibly damaging Het
Pclo C T 5: 14,681,749 R296* probably null Het
Pdzd2 A T 15: 12,458,058 C240S possibly damaging Het
Plekhg5 A G 4: 152,114,120 T922A probably benign Het
Plekhm2 A C 4: 141,642,070 L101R probably damaging Het
Plscr3 T A 11: 69,847,994 C161S probably benign Het
Prr14l C T 5: 32,828,915 D1079N probably benign Het
Ptpru A T 4: 131,771,179 V1377E possibly damaging Het
Rab37 C A 11: 115,158,702 D112E probably benign Het
Raet1e T A 10: 22,174,375 I19N probably damaging Het
Rassf5 T C 1: 131,245,066 Y22C probably damaging Het
Rp1 T C 1: 4,346,498 T1464A probably benign Het
Safb T A 17: 56,601,092 probably benign Het
Scarf2 A G 16: 17,806,505 probably null Het
Sh3d19 T C 3: 86,106,973 S415P probably benign Het
Slc26a9 T A 1: 131,763,804 L595Q probably damaging Het
Slc4a8 T C 15: 100,796,550 Y470H probably damaging Het
Slitrk3 T C 3: 73,049,649 N597D probably benign Het
Spata31 T A 13: 64,922,213 V725E probably benign Het
Spink12 T A 18: 44,107,764 C72* probably null Het
Spink5 T A 18: 44,012,975 probably null Het
Stk40 C A 4: 126,118,332 S9* probably null Het
Sypl A T 12: 32,965,421 T40S probably damaging Het
Tbc1d8 C T 1: 39,391,209 E438K probably benign Het
Tdrd7 A G 4: 45,989,102 T111A probably benign Het
Tg A T 15: 66,741,484 probably null Het
Tlr5 T A 1: 182,973,889 W253R probably damaging Het
Tmprss11c C T 5: 86,235,469 C353Y probably damaging Het
Tnfrsf8 T A 4: 145,288,027 M271L probably benign Het
Toe1 T C 4: 116,806,750 N21S probably benign Het
Tpp2 T C 1: 43,975,447 F649L probably benign Het
Ttll1 G A 15: 83,502,225 Q60* probably null Het
Vcp C T 4: 42,982,565 R709Q probably benign Het
Vmn1r119 T A 7: 21,011,668 H263L possibly damaging Het
Vmn1r195 C A 13: 22,278,941 Q194K probably damaging Het
Vmn1r33 T C 6: 66,611,799 Y257C probably damaging Het
Vmn2r15 A G 5: 109,293,015 F326L probably benign Het
Wbp11 A T 6: 136,816,110 probably benign Het
Wwp2 T G 8: 107,517,946 V250G probably benign Het
Xpnpep3 T C 15: 81,430,837 V246A probably benign Het
Zcchc14 G A 8: 121,605,449 R419* probably null Het
Other mutations in Kat2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Kat2b APN 17 53663623 missense possibly damaging 0.46
IGL00793:Kat2b APN 17 53665824 missense probably benign 0.00
IGL01628:Kat2b APN 17 53610897 missense possibly damaging 0.89
IGL02494:Kat2b APN 17 53653205 missense probably damaging 1.00
IGL03347:Kat2b APN 17 53624351 critical splice acceptor site probably null
D605:Kat2b UTSW 17 53629330 missense probably damaging 1.00
R0060:Kat2b UTSW 17 53654543 missense probably damaging 1.00
R0225:Kat2b UTSW 17 53641210 missense probably damaging 1.00
R0372:Kat2b UTSW 17 53638537 missense possibly damaging 0.95
R0638:Kat2b UTSW 17 53644743 splice site probably benign
R0780:Kat2b UTSW 17 53567448 missense unknown
R1240:Kat2b UTSW 17 53624397 missense probably benign 0.00
R2346:Kat2b UTSW 17 53610904 missense probably benign 0.07
R3402:Kat2b UTSW 17 53665853 missense probably damaging 1.00
R3776:Kat2b UTSW 17 53567581 splice site probably null
R4009:Kat2b UTSW 17 53644741 splice site probably null
R4011:Kat2b UTSW 17 53644741 splice site probably null
R4543:Kat2b UTSW 17 53653140 missense probably benign
R4598:Kat2b UTSW 17 53670798 missense probably benign 0.02
R4785:Kat2b UTSW 17 53653203 missense possibly damaging 0.81
R5079:Kat2b UTSW 17 53663638 missense probably damaging 1.00
R5475:Kat2b UTSW 17 53663581 missense probably damaging 1.00
R6993:Kat2b UTSW 17 53638522 missense probably damaging 1.00
R7047:Kat2b UTSW 17 53663569 missense probably benign 0.01
R7058:Kat2b UTSW 17 53665866 missense probably benign 0.00
R7199:Kat2b UTSW 17 53670678 missense probably damaging 1.00
R7276:Kat2b UTSW 17 53624422 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCCGCTAGGGTGGAGGAAGTT -3'
(R):5'- CCAGTGAGATGCTGTGCAAGCC -3'

Sequencing Primer
(F):5'- AGCTGCGGGTGACAGTC -3'
(R):5'- GAACGCAGCACTTCCGC -3'
Posted On2013-07-11