Incidental Mutation 'R0644:Elf2'
ID56993
Institutional Source Beutler Lab
Gene Symbol Elf2
Ensembl Gene ENSMUSG00000037174
Gene NameE74-like factor 2
Synonyms2610036A20Rik, A230104O07Rik, NERF-2
MMRRC Submission 038829-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.336) question?
Stock #R0644 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location51252720-51340663 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 51308131 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 53 (V53M)
Ref Sequence ENSEMBL: ENSMUSP00000139360 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062009] [ENSMUST00000091144] [ENSMUST00000163748] [ENSMUST00000183338] [ENSMUST00000183463] [ENSMUST00000194641]
Predicted Effect probably damaging
Transcript: ENSMUST00000062009
AA Change: V53M

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000061076
Gene: ENSMUSG00000037174
AA Change: V53M

DomainStartEndE-ValueType
Pfam:Elf-1_N 2 108 2.2e-37 PFAM
low complexity region 130 142 N/A INTRINSIC
low complexity region 160 169 N/A INTRINSIC
ETS 195 282 1.28e-51 SMART
low complexity region 357 379 N/A INTRINSIC
low complexity region 411 421 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000091144
AA Change: V53M

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000088678
Gene: ENSMUSG00000037174
AA Change: V53M

DomainStartEndE-ValueType
Pfam:Elf-1_N 3 108 8.6e-38 PFAM
low complexity region 142 154 N/A INTRINSIC
low complexity region 172 181 N/A INTRINSIC
ETS 207 294 1.28e-51 SMART
low complexity region 369 391 N/A INTRINSIC
low complexity region 423 433 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163748
AA Change: V53M

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000126871
Gene: ENSMUSG00000037174
AA Change: V53M

DomainStartEndE-ValueType
Pfam:Elf-1_N 2 108 1.2e-37 PFAM
low complexity region 142 154 N/A INTRINSIC
low complexity region 172 181 N/A INTRINSIC
ETS 207 294 1.28e-51 SMART
low complexity region 369 391 N/A INTRINSIC
low complexity region 423 433 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000183338
AA Change: V53M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139358
Gene: ENSMUSG00000037174
AA Change: V53M

DomainStartEndE-ValueType
Pfam:Elf-1_N 2 80 3.2e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000183463
AA Change: V53M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139360
Gene: ENSMUSG00000037174
AA Change: V53M

DomainStartEndE-ValueType
Pfam:Elf-1_N 2 85 2.2e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194209
Predicted Effect probably damaging
Transcript: ENSMUST00000194641
AA Change: V53M

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000141197
Gene: ENSMUSG00000037174
AA Change: V53M

DomainStartEndE-ValueType
Pfam:Elf-1_N 2 108 1.2e-37 PFAM
low complexity region 142 154 N/A INTRINSIC
low complexity region 172 181 N/A INTRINSIC
ETS 207 294 1.28e-51 SMART
low complexity region 369 391 N/A INTRINSIC
low complexity region 423 433 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg4 A T 9: 44,274,699 I625N possibly damaging Het
Accs A G 2: 93,839,229 L282P probably damaging Het
Acsbg1 T A 9: 54,609,826 I568F probably damaging Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Atp5o A T 16: 91,926,484 V73E probably damaging Het
Bcl9 T C 3: 97,210,497 S294G probably benign Het
C2cd5 A T 6: 143,013,224 M1003K probably damaging Het
Col6a5 A G 9: 105,948,324 probably null Het
Dera A T 6: 137,783,048 T165S probably benign Het
Dscr3 A G 16: 94,502,195 L182P probably damaging Het
Entpd5 A T 12: 84,386,141 F212L probably benign Het
Fam46d T C X: 107,870,645 F111S probably damaging Het
Fndc3c1 T A X: 106,434,962 T761S probably benign Het
Fsip2 A G 2: 82,976,897 T1187A probably benign Het
Golga2 T C 2: 32,297,521 S95P probably damaging Het
Hfm1 A T 5: 106,898,256 probably null Het
Impdh2 G T 9: 108,563,637 V112L possibly damaging Het
Kbtbd3 A T 9: 4,329,868 M81L probably damaging Het
Lactb T C 9: 66,955,890 R481G possibly damaging Het
Nacad C T 11: 6,599,486 C1235Y possibly damaging Het
Olfr1164 T A 2: 88,093,289 M216L probably benign Het
Olfr196 G A 16: 59,167,616 H176Y probably damaging Het
Osbpl6 C T 2: 76,594,840 R878C probably damaging Het
Polr3a G A 14: 24,484,164 P91L probably damaging Het
Rab27a T A 9: 73,095,423 S211R probably benign Het
Scn9a C T 2: 66,533,061 probably null Het
Shank2 T C 7: 144,411,849 S1065P probably benign Het
Tgm4 A T 9: 123,051,458 D308V probably damaging Het
Ythdf3 T C 3: 16,204,892 I412T possibly damaging Het
Zfp831 T C 2: 174,645,863 V777A probably benign Het
Other mutations in Elf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00917:Elf2 APN 3 51308046 critical splice donor site probably benign 0.00
IGL01577:Elf2 APN 3 51256352 utr 3 prime probably benign
IGL01829:Elf2 APN 3 51308100 missense probably damaging 0.98
IGL02974:Elf2 APN 3 51257689 missense probably damaging 0.98
IGL03244:Elf2 APN 3 51257772 nonsense probably null
IGL02980:Elf2 UTSW 3 51264958 missense possibly damaging 0.89
IGL03050:Elf2 UTSW 3 51257617 missense probably benign 0.05
R0254:Elf2 UTSW 3 51308190 missense probably damaging 1.00
R0594:Elf2 UTSW 3 51256453 missense possibly damaging 0.64
R1638:Elf2 UTSW 3 51308109 missense probably damaging 1.00
R1729:Elf2 UTSW 3 51257572 missense probably damaging 0.97
R1784:Elf2 UTSW 3 51257572 missense probably damaging 0.97
R2142:Elf2 UTSW 3 51256440 missense probably damaging 1.00
R2346:Elf2 UTSW 3 51257444 missense probably benign
R4366:Elf2 UTSW 3 51308149 nonsense probably null
R4672:Elf2 UTSW 3 51256434 missense probably damaging 1.00
R4834:Elf2 UTSW 3 51277221 missense probably damaging 1.00
R5514:Elf2 UTSW 3 51308134 missense probably damaging 1.00
R6198:Elf2 UTSW 3 51277249 missense probably damaging 1.00
R6870:Elf2 UTSW 3 51294165 makesense probably null
R7129:Elf2 UTSW 3 51261011 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CTGCTCCAGCAATGCTGATTCAAAG -3'
(R):5'- TGAAGCCGAGTCACAGCTAAATCC -3'

Sequencing Primer
(F):5'- tcccagcacccatgcag -3'
(R):5'- GTCACAGCTAAATCCAGAGTTGTC -3'
Posted On2013-07-11