Incidental Mutation 'R0644:Dera'
ID56999
Institutional Source Beutler Lab
Gene Symbol Dera
Ensembl Gene ENSMUSG00000030225
Gene Namedeoxyribose-phosphate aldolase (putative)
Synonyms2010002D22Rik, 2500002K03Rik
MMRRC Submission 038829-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0644 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location137754546-137857340 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 137783048 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 165 (T165S)
Ref Sequence ENSEMBL: ENSMUSP00000144935 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087675] [ENSMUST00000203216] [ENSMUST00000203693]
Predicted Effect probably benign
Transcript: ENSMUST00000087675
AA Change: T165S

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000084959
Gene: ENSMUSG00000030225
AA Change: T165S

DomainStartEndE-ValueType
DeoC 49 299 1.16e-79 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203046
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203136
Predicted Effect probably benign
Transcript: ENSMUST00000203216
SMART Domains Protein: ENSMUSP00000145264
Gene: ENSMUSG00000030225

DomainStartEndE-ValueType
Pfam:DeoC 2 97 1e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203693
AA Change: T165S

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000144935
Gene: ENSMUSG00000030225
AA Change: T165S

DomainStartEndE-ValueType
DeoC 49 271 4.4e-50 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203754
Predicted Effect probably benign
Transcript: ENSMUST00000204356
Predicted Effect unknown
Transcript: ENSMUST00000204779
AA Change: T41S
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg4 A T 9: 44,274,699 I625N possibly damaging Het
Accs A G 2: 93,839,229 L282P probably damaging Het
Acsbg1 T A 9: 54,609,826 I568F probably damaging Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Atp5o A T 16: 91,926,484 V73E probably damaging Het
Bcl9 T C 3: 97,210,497 S294G probably benign Het
C2cd5 A T 6: 143,013,224 M1003K probably damaging Het
Col6a5 A G 9: 105,948,324 probably null Het
Dscr3 A G 16: 94,502,195 L182P probably damaging Het
Elf2 C T 3: 51,308,131 V53M probably damaging Het
Entpd5 A T 12: 84,386,141 F212L probably benign Het
Fam46d T C X: 107,870,645 F111S probably damaging Het
Fndc3c1 T A X: 106,434,962 T761S probably benign Het
Fsip2 A G 2: 82,976,897 T1187A probably benign Het
Golga2 T C 2: 32,297,521 S95P probably damaging Het
Hfm1 A T 5: 106,898,256 probably null Het
Impdh2 G T 9: 108,563,637 V112L possibly damaging Het
Kbtbd3 A T 9: 4,329,868 M81L probably damaging Het
Lactb T C 9: 66,955,890 R481G possibly damaging Het
Nacad C T 11: 6,599,486 C1235Y possibly damaging Het
Olfr1164 T A 2: 88,093,289 M216L probably benign Het
Olfr196 G A 16: 59,167,616 H176Y probably damaging Het
Osbpl6 C T 2: 76,594,840 R878C probably damaging Het
Polr3a G A 14: 24,484,164 P91L probably damaging Het
Rab27a T A 9: 73,095,423 S211R probably benign Het
Scn9a C T 2: 66,533,061 probably null Het
Shank2 T C 7: 144,411,849 S1065P probably benign Het
Tgm4 A T 9: 123,051,458 D308V probably damaging Het
Ythdf3 T C 3: 16,204,892 I412T possibly damaging Het
Zfp831 T C 2: 174,645,863 V777A probably benign Het
Other mutations in Dera
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02134:Dera APN 6 137830271 missense probably damaging 1.00
IGL02220:Dera APN 6 137780817 unclassified probably null
IGL02449:Dera APN 6 137780817 unclassified probably null
IGL03256:Dera APN 6 137779645 missense probably benign 0.00
R0691:Dera UTSW 6 137796747 intron probably benign
R0733:Dera UTSW 6 137796848 missense probably damaging 1.00
R1478:Dera UTSW 6 137830195 missense possibly damaging 0.91
R3950:Dera UTSW 6 137837120 missense probably damaging 0.99
R3951:Dera UTSW 6 137837120 missense probably damaging 0.99
R3952:Dera UTSW 6 137837120 missense probably damaging 0.99
R4561:Dera UTSW 6 137780738 missense possibly damaging 0.83
Z1088:Dera UTSW 6 137837118 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- GCCTCATTTCTCAAAGCCGCAC -3'
(R):5'- TGCCCCTAACTACACAGAGAGTCG -3'

Sequencing Primer
(F):5'- ACTGACCAATTGAGGTTTGTCC -3'
(R):5'- AGAGAGTCGTAACCTGTTCCTAC -3'
Posted On2013-07-11