Incidental Mutation 'R0644:Kbtbd3'
ID57003
Institutional Source Beutler Lab
Gene Symbol Kbtbd3
Ensembl Gene ENSMUSG00000025893
Gene Namekelch repeat and BTB (POZ) domain containing 3
SynonymsBklhd3, 2200003A07Rik
MMRRC Submission 038829-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.248) question?
Stock #R0644 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location4309833-4331732 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 4329868 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 81 (M81L)
Ref Sequence ENSEMBL: ENSMUSP00000148445 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049648] [ENSMUST00000212221]
Predicted Effect probably damaging
Transcript: ENSMUST00000049648
AA Change: M81L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000050183
Gene: ENSMUSG00000025893
AA Change: M81L

DomainStartEndE-ValueType
BTB 48 145 1.83e-23 SMART
BACK 150 252 1.19e-26 SMART
Blast:Kelch 292 338 7e-15 BLAST
Kelch 339 399 2.56e0 SMART
Kelch 400 450 8.67e-4 SMART
Kelch 548 597 3.3e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000212221
AA Change: M81L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg4 A T 9: 44,274,699 I625N possibly damaging Het
Accs A G 2: 93,839,229 L282P probably damaging Het
Acsbg1 T A 9: 54,609,826 I568F probably damaging Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Atp5o A T 16: 91,926,484 V73E probably damaging Het
Bcl9 T C 3: 97,210,497 S294G probably benign Het
C2cd5 A T 6: 143,013,224 M1003K probably damaging Het
Col6a5 A G 9: 105,948,324 probably null Het
Dera A T 6: 137,783,048 T165S probably benign Het
Dscr3 A G 16: 94,502,195 L182P probably damaging Het
Elf2 C T 3: 51,308,131 V53M probably damaging Het
Entpd5 A T 12: 84,386,141 F212L probably benign Het
Fam46d T C X: 107,870,645 F111S probably damaging Het
Fndc3c1 T A X: 106,434,962 T761S probably benign Het
Fsip2 A G 2: 82,976,897 T1187A probably benign Het
Golga2 T C 2: 32,297,521 S95P probably damaging Het
Hfm1 A T 5: 106,898,256 probably null Het
Impdh2 G T 9: 108,563,637 V112L possibly damaging Het
Lactb T C 9: 66,955,890 R481G possibly damaging Het
Nacad C T 11: 6,599,486 C1235Y possibly damaging Het
Olfr1164 T A 2: 88,093,289 M216L probably benign Het
Olfr196 G A 16: 59,167,616 H176Y probably damaging Het
Osbpl6 C T 2: 76,594,840 R878C probably damaging Het
Polr3a G A 14: 24,484,164 P91L probably damaging Het
Rab27a T A 9: 73,095,423 S211R probably benign Het
Scn9a C T 2: 66,533,061 probably null Het
Shank2 T C 7: 144,411,849 S1065P probably benign Het
Tgm4 A T 9: 123,051,458 D308V probably damaging Het
Ythdf3 T C 3: 16,204,892 I412T possibly damaging Het
Zfp831 T C 2: 174,645,863 V777A probably benign Het
Other mutations in Kbtbd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00642:Kbtbd3 APN 9 4330169 missense probably benign
IGL00674:Kbtbd3 APN 9 4329949 missense probably benign 0.05
IGL00848:Kbtbd3 APN 9 4331184 missense probably damaging 1.00
IGL01949:Kbtbd3 APN 9 4331066 missense possibly damaging 0.95
IGL02619:Kbtbd3 APN 9 4331252 missense probably damaging 1.00
IGL02830:Kbtbd3 APN 9 4330096 missense possibly damaging 0.95
IGL02894:Kbtbd3 APN 9 4331444 missense probably benign 0.05
R0239:Kbtbd3 UTSW 9 4330144 missense possibly damaging 0.62
R0239:Kbtbd3 UTSW 9 4330144 missense possibly damaging 0.62
R0348:Kbtbd3 UTSW 9 4330519 missense possibly damaging 0.94
R0372:Kbtbd3 UTSW 9 4316950 missense possibly damaging 0.75
R0380:Kbtbd3 UTSW 9 4330545 nonsense probably null
R1496:Kbtbd3 UTSW 9 4330276 missense probably benign
R1651:Kbtbd3 UTSW 9 4330589 missense possibly damaging 0.62
R1707:Kbtbd3 UTSW 9 4316985 missense probably benign 0.01
R1998:Kbtbd3 UTSW 9 4330760 missense probably benign 0.01
R2012:Kbtbd3 UTSW 9 4330919 missense probably benign
R2027:Kbtbd3 UTSW 9 4317075 splice site probably benign
R3717:Kbtbd3 UTSW 9 4330598 missense probably benign
R4463:Kbtbd3 UTSW 9 4331257 missense probably damaging 0.99
R4482:Kbtbd3 UTSW 9 4331051 missense probably damaging 1.00
R4795:Kbtbd3 UTSW 9 4331073 nonsense probably null
R5195:Kbtbd3 UTSW 9 4316905 missense possibly damaging 0.74
R5645:Kbtbd3 UTSW 9 4331426 missense possibly damaging 0.92
R5753:Kbtbd3 UTSW 9 4331404 missense possibly damaging 0.74
R5898:Kbtbd3 UTSW 9 4330476 missense probably damaging 0.97
R6463:Kbtbd3 UTSW 9 4316921 missense probably benign
R6681:Kbtbd3 UTSW 9 4330687 missense probably benign 0.00
R7284:Kbtbd3 UTSW 9 4330690 nonsense probably null
X0024:Kbtbd3 UTSW 9 4331437 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGTAGCAGTGGGCCTCTCATTTTC -3'
(R):5'- TGACTGAACAACTGGGCAGAGC -3'

Sequencing Primer
(F):5'- CTTTCTGTGTATCAGCTACACTG -3'
(R):5'- CCGTAGCTGTCTGACAGAGATAAC -3'
Posted On2013-07-11