Incidental Mutation 'R0644:Rab27a'
ID57007
Institutional Source Beutler Lab
Gene Symbol Rab27a
Ensembl Gene ENSMUSG00000032202
Gene NameRAB27A, member RAS oncogene family
Synonyms4933437C11Rik, 2210402C08Rik, 2410003M20Rik
MMRRC Submission 038829-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.458) question?
Stock #R0644 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location73044854-73097629 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 73095423 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 211 (S211R)
Ref Sequence ENSEMBL: ENSMUSP00000139310 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034722] [ENSMUST00000184146]
Predicted Effect probably benign
Transcript: ENSMUST00000034722
AA Change: S211R

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000034722
Gene: ENSMUSG00000032202
AA Change: S211R

DomainStartEndE-ValueType
RAB 10 184 9.9e-92 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184032
Predicted Effect probably benign
Transcript: ENSMUST00000184146
AA Change: S211R

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000139310
Gene: ENSMUSG00000032202
AA Change: S211R

DomainStartEndE-ValueType
RAB 10 184 9.9e-92 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the Rab family of proteins, which is the largest family within the Ras superfamily of GTPases. This gene product is thought to regulate vesicular transport, together with its specific effectors. Mutations in this gene cause several defects, including actin-based melanosome transport defects and immunodeficiency. Mutations in the human ortholog of this gene are associated with Griscelli syndrome type 2. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygotes have abnormal melanocyte development producing abnormal pigmentation and a gray coat color. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg4 A T 9: 44,274,699 I625N possibly damaging Het
Accs A G 2: 93,839,229 L282P probably damaging Het
Acsbg1 T A 9: 54,609,826 I568F probably damaging Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Atp5o A T 16: 91,926,484 V73E probably damaging Het
Bcl9 T C 3: 97,210,497 S294G probably benign Het
C2cd5 A T 6: 143,013,224 M1003K probably damaging Het
Col6a5 A G 9: 105,948,324 probably null Het
Dera A T 6: 137,783,048 T165S probably benign Het
Dscr3 A G 16: 94,502,195 L182P probably damaging Het
Elf2 C T 3: 51,308,131 V53M probably damaging Het
Entpd5 A T 12: 84,386,141 F212L probably benign Het
Fam46d T C X: 107,870,645 F111S probably damaging Het
Fndc3c1 T A X: 106,434,962 T761S probably benign Het
Fsip2 A G 2: 82,976,897 T1187A probably benign Het
Golga2 T C 2: 32,297,521 S95P probably damaging Het
Hfm1 A T 5: 106,898,256 probably null Het
Impdh2 G T 9: 108,563,637 V112L possibly damaging Het
Kbtbd3 A T 9: 4,329,868 M81L probably damaging Het
Lactb T C 9: 66,955,890 R481G possibly damaging Het
Nacad C T 11: 6,599,486 C1235Y possibly damaging Het
Olfr1164 T A 2: 88,093,289 M216L probably benign Het
Olfr196 G A 16: 59,167,616 H176Y probably damaging Het
Osbpl6 C T 2: 76,594,840 R878C probably damaging Het
Polr3a G A 14: 24,484,164 P91L probably damaging Het
Scn9a C T 2: 66,533,061 probably null Het
Shank2 T C 7: 144,411,849 S1065P probably benign Het
Tgm4 A T 9: 123,051,458 D308V probably damaging Het
Ythdf3 T C 3: 16,204,892 I412T possibly damaging Het
Zfp831 T C 2: 174,645,863 V777A probably benign Het
Other mutations in Rab27a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01144:Rab27a APN 9 73075568 critical splice donor site probably null
IGL02000:Rab27a APN 9 73084972 missense probably damaging 1.00
concrete UTSW 9 73082409 missense possibly damaging 0.89
geodude UTSW 9 73084981 missense probably damaging 1.00
ivan UTSW 9 73075544 missense probably damaging 0.99
R0671:Rab27a UTSW 9 73075433 missense probably damaging 1.00
R1481:Rab27a UTSW 9 73082402 missense probably benign 0.13
R1522:Rab27a UTSW 9 73075482 missense probably damaging 1.00
R1531:Rab27a UTSW 9 73095403 missense probably benign
R1634:Rab27a UTSW 9 73075569 critical splice donor site probably null
R1950:Rab27a UTSW 9 73075469 missense probably damaging 1.00
R2497:Rab27a UTSW 9 73084981 missense probably damaging 1.00
R4083:Rab27a UTSW 9 73082439 missense probably damaging 0.96
R4094:Rab27a UTSW 9 73075544 missense probably damaging 0.99
R5027:Rab27a UTSW 9 73095413 missense probably benign 0.01
R5881:Rab27a UTSW 9 73085039 splice site probably null
R6750:Rab27a UTSW 9 73085008 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGGTTTTGAGAGGTACACACAGTGG -3'
(R):5'- TTACAGATGGATGCCCGAGGTGAC -3'

Sequencing Primer
(F):5'- GCACTACTGAAGTCACACTGTTG -3'
(R):5'- CCGAGGTGACCCTCCTG -3'
Posted On2013-07-11