Incidental Mutation 'R0644:Tgm4'
ID57010
Institutional Source Beutler Lab
Gene Symbol Tgm4
Ensembl Gene ENSMUSG00000025787
Gene Nametransglutaminase 4 (prostate)
Synonyms9530008N10Rik, Eapa1, experimental autoimmune prostatitis antigen 1
MMRRC Submission 038829-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R0644 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location123034726-123067561 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 123051458 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 308 (D308V)
Ref Sequence ENSEMBL: ENSMUSP00000026893 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026893] [ENSMUST00000215247] [ENSMUST00000217607]
Predicted Effect probably damaging
Transcript: ENSMUST00000026893
AA Change: D308V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026893
Gene: ENSMUSG00000025787
AA Change: D308V

DomainStartEndE-ValueType
Pfam:Transglut_N 8 118 4e-26 PFAM
TGc 247 340 6.25e-42 SMART
Pfam:Transglut_C 573 670 3e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128572
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171897
Predicted Effect probably benign
Transcript: ENSMUST00000215247
Predicted Effect probably benign
Transcript: ENSMUST00000217607
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired copulatory plug formation, reduced fertilization and few litters sired. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg4 A T 9: 44,274,699 I625N possibly damaging Het
Accs A G 2: 93,839,229 L282P probably damaging Het
Acsbg1 T A 9: 54,609,826 I568F probably damaging Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Atp5o A T 16: 91,926,484 V73E probably damaging Het
Bcl9 T C 3: 97,210,497 S294G probably benign Het
C2cd5 A T 6: 143,013,224 M1003K probably damaging Het
Col6a5 A G 9: 105,948,324 probably null Het
Dera A T 6: 137,783,048 T165S probably benign Het
Dscr3 A G 16: 94,502,195 L182P probably damaging Het
Elf2 C T 3: 51,308,131 V53M probably damaging Het
Entpd5 A T 12: 84,386,141 F212L probably benign Het
Fam46d T C X: 107,870,645 F111S probably damaging Het
Fndc3c1 T A X: 106,434,962 T761S probably benign Het
Fsip2 A G 2: 82,976,897 T1187A probably benign Het
Golga2 T C 2: 32,297,521 S95P probably damaging Het
Hfm1 A T 5: 106,898,256 probably null Het
Impdh2 G T 9: 108,563,637 V112L possibly damaging Het
Kbtbd3 A T 9: 4,329,868 M81L probably damaging Het
Lactb T C 9: 66,955,890 R481G possibly damaging Het
Nacad C T 11: 6,599,486 C1235Y possibly damaging Het
Olfr1164 T A 2: 88,093,289 M216L probably benign Het
Olfr196 G A 16: 59,167,616 H176Y probably damaging Het
Osbpl6 C T 2: 76,594,840 R878C probably damaging Het
Polr3a G A 14: 24,484,164 P91L probably damaging Het
Rab27a T A 9: 73,095,423 S211R probably benign Het
Scn9a C T 2: 66,533,061 probably null Het
Shank2 T C 7: 144,411,849 S1065P probably benign Het
Ythdf3 T C 3: 16,204,892 I412T possibly damaging Het
Zfp831 T C 2: 174,645,863 V777A probably benign Het
Other mutations in Tgm4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Tgm4 APN 9 123062382 unclassified probably benign
IGL01402:Tgm4 APN 9 123051454 missense possibly damaging 0.82
IGL02000:Tgm4 APN 9 123056466 missense probably damaging 1.00
IGL02120:Tgm4 APN 9 123046529 missense probably damaging 0.98
IGL03130:Tgm4 APN 9 123056515 missense probably damaging 1.00
IGL03188:Tgm4 APN 9 123045036 missense probably null 0.06
R0329:Tgm4 UTSW 9 123048557 critical splice donor site probably null
R0480:Tgm4 UTSW 9 123062419 missense probably benign
R0990:Tgm4 UTSW 9 123046511 missense probably benign 0.02
R1604:Tgm4 UTSW 9 123045064 missense probably benign 0.39
R1644:Tgm4 UTSW 9 123051416 missense probably damaging 1.00
R2056:Tgm4 UTSW 9 123061770 missense probably damaging 1.00
R2058:Tgm4 UTSW 9 123061770 missense probably damaging 1.00
R2059:Tgm4 UTSW 9 123061770 missense probably damaging 1.00
R2076:Tgm4 UTSW 9 123051095 missense probably benign 0.24
R2437:Tgm4 UTSW 9 123048549 nonsense probably null
R4392:Tgm4 UTSW 9 123066752 missense probably benign 0.10
R4407:Tgm4 UTSW 9 123056530 missense probably damaging 1.00
R4752:Tgm4 UTSW 9 123051386 missense probably damaging 1.00
R5288:Tgm4 UTSW 9 123056494 missense probably damaging 1.00
R5365:Tgm4 UTSW 9 123066801 missense probably damaging 1.00
R5386:Tgm4 UTSW 9 123056494 missense probably damaging 1.00
R5790:Tgm4 UTSW 9 123061743 missense probably damaging 0.98
R5890:Tgm4 UTSW 9 123061638 missense probably damaging 1.00
R6102:Tgm4 UTSW 9 123056535 missense probably benign
R6358:Tgm4 UTSW 9 123056518 missense probably damaging 1.00
R6956:Tgm4 UTSW 9 123064703 missense possibly damaging 0.93
R6966:Tgm4 UTSW 9 123051142 missense possibly damaging 0.68
R7091:Tgm4 UTSW 9 123040460 missense probably damaging 1.00
R7258:Tgm4 UTSW 9 123062491 missense probably benign 0.02
R7313:Tgm4 UTSW 9 123062491 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CTGCTCAGTTCCCACAGAAGCTAAC -3'
(R):5'- TGTGACACACAGCAACCTGTCTC -3'

Sequencing Primer
(F):5'- GCTAACAATCCCGCCCTG -3'
(R):5'- GGGCCAGAAGTAAATACCAATTCTTG -3'
Posted On2013-07-11