Incidental Mutation 'R0644:Dscr3'
ID57018
Institutional Source Beutler Lab
Gene Symbol Dscr3
Ensembl Gene ENSMUSG00000022898
Gene NameDSCR3 arrestin fold containing
SynonymsDcra
MMRRC Submission 038829-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.192) question?
Stock #R0644 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location94497783-94526830 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 94502195 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 182 (L182P)
Ref Sequence ENSEMBL: ENSMUSP00000023615 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023615] [ENSMUST00000125229]
Predicted Effect probably damaging
Transcript: ENSMUST00000023615
AA Change: L182P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023615
Gene: ENSMUSG00000022898
AA Change: L182P

DomainStartEndE-ValueType
Pfam:Vps26 3 283 2.5e-79 PFAM
Pfam:Arrestin_N 5 144 9.7e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125229
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127449
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210205
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232569
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The region of chromosome 21 between genes CBR and ERG (CBR-ERG region), which spans 2.5 Mb on 21q22.2, has been defined by analysis of patients with partial trisomy 21. It contributes significantly to the pathogenesis of many characteristics of Down syndrome, including morphological features, hypotonia, and mental retardation. The DSCR3 (Down syndrome critical region gene 3) gene is found in this region and is predictated to contain eight exons. DSCR3 is expressed in most tissues examined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg4 A T 9: 44,274,699 I625N possibly damaging Het
Accs A G 2: 93,839,229 L282P probably damaging Het
Acsbg1 T A 9: 54,609,826 I568F probably damaging Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Atp5o A T 16: 91,926,484 V73E probably damaging Het
Bcl9 T C 3: 97,210,497 S294G probably benign Het
C2cd5 A T 6: 143,013,224 M1003K probably damaging Het
Col6a5 A G 9: 105,948,324 probably null Het
Dera A T 6: 137,783,048 T165S probably benign Het
Elf2 C T 3: 51,308,131 V53M probably damaging Het
Entpd5 A T 12: 84,386,141 F212L probably benign Het
Fam46d T C X: 107,870,645 F111S probably damaging Het
Fndc3c1 T A X: 106,434,962 T761S probably benign Het
Fsip2 A G 2: 82,976,897 T1187A probably benign Het
Golga2 T C 2: 32,297,521 S95P probably damaging Het
Hfm1 A T 5: 106,898,256 probably null Het
Impdh2 G T 9: 108,563,637 V112L possibly damaging Het
Kbtbd3 A T 9: 4,329,868 M81L probably damaging Het
Lactb T C 9: 66,955,890 R481G possibly damaging Het
Nacad C T 11: 6,599,486 C1235Y possibly damaging Het
Olfr1164 T A 2: 88,093,289 M216L probably benign Het
Olfr196 G A 16: 59,167,616 H176Y probably damaging Het
Osbpl6 C T 2: 76,594,840 R878C probably damaging Het
Polr3a G A 14: 24,484,164 P91L probably damaging Het
Rab27a T A 9: 73,095,423 S211R probably benign Het
Scn9a C T 2: 66,533,061 probably null Het
Shank2 T C 7: 144,411,849 S1065P probably benign Het
Tgm4 A T 9: 123,051,458 D308V probably damaging Het
Ythdf3 T C 3: 16,204,892 I412T possibly damaging Het
Zfp831 T C 2: 174,645,863 V777A probably benign Het
Other mutations in Dscr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02197:Dscr3 APN 16 94501690 splice site probably benign
R1256:Dscr3 UTSW 16 94512366 missense probably damaging 1.00
R1973:Dscr3 UTSW 16 94501546 missense probably damaging 0.99
R2286:Dscr3 UTSW 16 94512253 missense possibly damaging 0.69
R3854:Dscr3 UTSW 16 94510806 missense probably benign 0.01
R3855:Dscr3 UTSW 16 94510806 missense probably benign 0.01
R5067:Dscr3 UTSW 16 94526404 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TGATGTGCCCTGCCATGTTAAGAG -3'
(R):5'- AGCTGTGATGTCCGTTTGTCCC -3'

Sequencing Primer
(F):5'- GTACAggaaggggtgttttagc -3'
(R):5'- GATGTCCGTTTGTCCCTAATATG -3'
Posted On2013-07-11