Incidental Mutation 'R0644:Fndc3c1'
ID57019
Institutional Source Beutler Lab
Gene Symbol Fndc3c1
Ensembl Gene ENSMUSG00000033737
Gene Namefibronectin type III domain containing 3C1
SynonymsLOC333564
MMRRC Submission 038829-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R0644 (G1)
Quality Score225
Status Not validated
ChromosomeX
Chromosomal Location106420041-106485401 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 106434962 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 761 (T761S)
Ref Sequence ENSEMBL: ENSMUSP00000038678 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039447]
Predicted Effect probably benign
Transcript: ENSMUST00000039447
AA Change: T761S

PolyPhen 2 Score 0.143 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000038678
Gene: ENSMUSG00000033737
AA Change: T761S

DomainStartEndE-ValueType
low complexity region 182 195 N/A INTRINSIC
Blast:FN3 200 303 8e-10 BLAST
low complexity region 308 332 N/A INTRINSIC
low complexity region 338 353 N/A INTRINSIC
FN3 449 537 2.64e-1 SMART
FN3 551 631 2.42e-9 SMART
FN3 646 728 1.37e-8 SMART
FN3 743 827 1.11e-3 SMART
FN3 915 994 3.42e-9 SMART
FN3 1015 1090 5.48e-8 SMART
FN3 1104 1185 2.48e-6 SMART
FN3 1200 1278 1.9e-2 SMART
low complexity region 1298 1313 N/A INTRINSIC
transmembrane domain 1333 1355 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127796
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137507
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151745
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg4 A T 9: 44,274,699 I625N possibly damaging Het
Accs A G 2: 93,839,229 L282P probably damaging Het
Acsbg1 T A 9: 54,609,826 I568F probably damaging Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Atp5o A T 16: 91,926,484 V73E probably damaging Het
Bcl9 T C 3: 97,210,497 S294G probably benign Het
C2cd5 A T 6: 143,013,224 M1003K probably damaging Het
Col6a5 A G 9: 105,948,324 probably null Het
Dera A T 6: 137,783,048 T165S probably benign Het
Dscr3 A G 16: 94,502,195 L182P probably damaging Het
Elf2 C T 3: 51,308,131 V53M probably damaging Het
Entpd5 A T 12: 84,386,141 F212L probably benign Het
Fam46d T C X: 107,870,645 F111S probably damaging Het
Fsip2 A G 2: 82,976,897 T1187A probably benign Het
Golga2 T C 2: 32,297,521 S95P probably damaging Het
Hfm1 A T 5: 106,898,256 probably null Het
Impdh2 G T 9: 108,563,637 V112L possibly damaging Het
Kbtbd3 A T 9: 4,329,868 M81L probably damaging Het
Lactb T C 9: 66,955,890 R481G possibly damaging Het
Nacad C T 11: 6,599,486 C1235Y possibly damaging Het
Olfr1164 T A 2: 88,093,289 M216L probably benign Het
Olfr196 G A 16: 59,167,616 H176Y probably damaging Het
Osbpl6 C T 2: 76,594,840 R878C probably damaging Het
Polr3a G A 14: 24,484,164 P91L probably damaging Het
Rab27a T A 9: 73,095,423 S211R probably benign Het
Scn9a C T 2: 66,533,061 probably null Het
Shank2 T C 7: 144,411,849 S1065P probably benign Het
Tgm4 A T 9: 123,051,458 D308V probably damaging Het
Ythdf3 T C 3: 16,204,892 I412T possibly damaging Het
Zfp831 T C 2: 174,645,863 V777A probably benign Het
Other mutations in Fndc3c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00670:Fndc3c1 APN X 106445777 missense probably benign
IGL01408:Fndc3c1 APN X 106432772 missense probably benign 0.45
IGL01518:Fndc3c1 APN X 106431423 missense probably damaging 1.00
IGL01718:Fndc3c1 APN X 106445928 missense probably benign
IGL02143:Fndc3c1 APN X 106472734 splice site probably benign
IGL02214:Fndc3c1 APN X 106425829 missense probably benign 0.16
IGL03192:Fndc3c1 APN X 106436316 splice site probably null
IGL03199:Fndc3c1 APN X 106436387 missense possibly damaging 0.86
IGL03370:Fndc3c1 APN X 106420701 missense probably benign 0.04
R0714:Fndc3c1 UTSW X 106425366 nonsense probably null
R1928:Fndc3c1 UTSW X 106433522 missense probably benign 0.28
R1998:Fndc3c1 UTSW X 106420705 missense probably benign 0.01
R1999:Fndc3c1 UTSW X 106420705 missense probably benign 0.01
R4110:Fndc3c1 UTSW X 106444291 missense probably benign 0.07
R4785:Fndc3c1 UTSW X 106437702 missense possibly damaging 0.87
R6623:Fndc3c1 UTSW X 106435073 missense possibly damaging 0.55
R7173:Fndc3c1 UTSW X 106435073 missense possibly damaging 0.55
R7208:Fndc3c1 UTSW X 106435073 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- AGCCATCAAGCATTTAGATAGCATTTCAAAC -3'
(R):5'- AGCTGACTCTCTACATATTACTAAACTGCACA -3'

Sequencing Primer
(F):5'- GGCTAAGCTGACATTCATGTTTC -3'
(R):5'- CTGCACATTAATTTTCAGTGATCAAC -3'
Posted On2013-07-11