Incidental Mutation 'R7346:Klb'
ID570196
Institutional Source Beutler Lab
Gene Symbol Klb
Ensembl Gene ENSMUSG00000029195
Gene Nameklotho beta
SynonymsbetaKlotho
MMRRC Submission
Accession Numbers

Genbank: NM_031180.2; Ensembl: ENSMUST00000031096;

MGI:1932466

Is this an essential gene? Possibly essential (E-score: 0.561) question?
Stock #R7346 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location65348314-65384007 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 65348631 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 74 (Q74*)
Ref Sequence ENSEMBL: ENSMUSP00000031096 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031096] [ENSMUST00000205084]
Predicted Effect probably null
Transcript: ENSMUST00000031096
AA Change: Q74*
SMART Domains Protein: ENSMUSP00000031096
Gene: ENSMUSG00000029195
AA Change: Q74*

DomainStartEndE-ValueType
Pfam:Glyco_hydro_1 77 385 8.8e-96 PFAM
Pfam:Glyco_hydro_1 374 506 1.7e-31 PFAM
Pfam:Glyco_hydro_1 515 965 6.3e-80 PFAM
transmembrane domain 995 1017 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000205084
AA Change: Q74*
SMART Domains Protein: ENSMUSP00000145091
Gene: ENSMUSG00000029195
AA Change: Q74*

DomainStartEndE-ValueType
Pfam:Glyco_hydro_1 77 360 8.6e-94 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype Strain: 3587748
PHENOTYPE: Homozygous null mice display increased bile acid synthesis and excretion, resistance to gallstone formation, and slightly decreased body weight. Mice homozygous for a knock-out allele or a conditional allele activated in adipose tissue exhibit resistanceto FGF21-induced metabolic disruptions. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted(2) Gene trapped(3)

Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik G A 9: 56,007,303 P52S unknown Het
Adarb2 A G 13: 8,570,384 E302G probably damaging Het
Adgrf5 T A 17: 43,451,179 L1255H probably damaging Het
Adra1a T A 14: 66,638,284 I236N probably benign Het
As3mt T C 19: 46,720,452 F295S probably damaging Het
Bmp5 G A 9: 75,873,360 R313Q probably damaging Het
Ccnj T A 19: 40,844,950 S191T probably benign Het
Clk2 T A 3: 89,173,545 probably null Het
Cpz T C 5: 35,517,656 E83G probably damaging Het
Cts3 A G 13: 61,567,620 I133T probably benign Het
Dsel A T 1: 111,861,068 V579D probably damaging Het
Dync1h1 C A 12: 110,635,642 A2038E probably damaging Het
Eaf1 A G 14: 31,494,820 probably benign Het
Fsip2 A C 2: 82,998,180 I6774L probably benign Het
Glis2 T C 16: 4,613,568 F320L possibly damaging Het
Hcar1 A G 5: 123,879,630 probably benign Het
Hectd1 A T 12: 51,750,321 H2211Q probably benign Het
Hmcn1 A G 1: 150,683,745 I2385T probably damaging Het
Ifi44 T A 3: 151,732,457 M398L probably benign Het
Il16 C T 7: 83,644,041 E1273K probably damaging Het
Inpp5j G A 11: 3,501,065 T528I probably damaging Het
Kbtbd6 C T 14: 79,453,187 P441S probably damaging Het
Kcnt1 C T 2: 25,863,843 probably benign Het
Kif26b T C 1: 178,530,741 L139P probably damaging Het
L3mbtl1 G A 2: 162,967,006 V600I probably benign Het
Lcp1 C T 14: 75,210,506 A317V possibly damaging Het
Lipc C T 9: 70,812,747 G326D probably damaging Het
Mbnl2 T A 14: 120,379,282 F103I probably benign Het
Mdm1 G T 10: 118,164,288 E609* probably null Het
Med16 A G 10: 79,908,816 probably null Het
Mga T C 2: 119,935,527 V1424A possibly damaging Het
Mpc2 T A 1: 165,479,511 W94R probably damaging Het
Mrm3 G A 11: 76,250,176 V337I possibly damaging Het
N4bp3 T C 11: 51,645,606 H133R probably benign Het
Ncam2 G T 16: 81,623,368 G810V probably damaging Het
Nipbl T C 15: 8,343,606 E1052G possibly damaging Het
Nlrp12 C T 7: 3,249,257 V95M probably damaging Het
Nrip1 T C 16: 76,293,356 N438D possibly damaging Het
Nsun4 C A 4: 116,051,838 M508I probably benign Het
Pla2g2c T C 4: 138,734,339 S40P probably damaging Het
Plec A G 15: 76,197,978 probably null Het
Ppfia2 G T 10: 106,857,495 M620I possibly damaging Het
Ppp6c A G 2: 39,226,217 Y9H probably damaging Het
Prkd1 A T 12: 50,648,834 I47N possibly damaging Het
Prr14l T C 5: 32,830,684 D489G probably benign Het
Ptch2 T A 4: 117,114,652 Y1124N probably benign Het
Ptpra T G 2: 130,553,400 Y808D probably damaging Het
Rint1 T A 5: 23,815,653 F558Y possibly damaging Het
Rnf215 T A 11: 4,139,792 C268* probably null Het
Slc25a13 T C 6: 6,181,100 E28G possibly damaging Het
Slc38a8 G T 8: 119,499,815 Y78* probably null Het
Slc4a7 T C 14: 14,775,000 M810T probably damaging Het
Slitrk1 A G 14: 108,913,159 V40A possibly damaging Het
Sobp A T 10: 43,022,835 S251R probably damaging Het
Spata31d1a G A 13: 59,703,201 S371L probably benign Het
Tada2b T C 5: 36,476,836 T133A possibly damaging Het
Tbc1d20 A G 2: 152,304,961 D90G probably benign Het
Tek T A 4: 94,827,296 I408K probably benign Het
Tgfb2 A G 1: 186,649,880 F150S probably benign Het
Tmem63b T C 17: 45,666,591 T370A probably benign Het
Tmem94 G T 11: 115,786,256 R118L possibly damaging Het
Tspan17 C G 13: 54,792,621 L34V probably benign Het
Vmn1r238 A T 18: 3,123,151 Y88N probably damaging Het
Vmn1r85 A G 7: 13,085,037 I60T probably damaging Het
Vmn2r96 T C 17: 18,582,767 M313T probably benign Het
Zp3r G A 1: 130,583,480 S387F probably benign Het
Other mutations in Klb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Klb APN 5 65372374 missense possibly damaging 0.90
IGL00821:Klb APN 5 65372149 missense probably damaging 1.00
IGL01082:Klb APN 5 65375940 missense possibly damaging 0.71
IGL01637:Klb APN 5 65375679 critical splice acceptor site probably null
IGL02098:Klb APN 5 65379885 missense probably benign 0.21
IGL03113:Klb APN 5 65383470 missense probably benign 0.00
1mM(1):Klb UTSW 5 65348650 missense probably damaging 1.00
P0016:Klb UTSW 5 65379923 nonsense probably null
R0268:Klb UTSW 5 65348837 missense probably benign 0.02
R0383:Klb UTSW 5 65372499 intron probably null
R0676:Klb UTSW 5 65379055 missense probably damaging 1.00
R0735:Klb UTSW 5 65379727 missense probably benign
R0972:Klb UTSW 5 65348746 missense possibly damaging 0.70
R1051:Klb UTSW 5 65379327 missense probably damaging 1.00
R1168:Klb UTSW 5 65378974 missense probably damaging 1.00
R1372:Klb UTSW 5 65348746 missense possibly damaging 0.70
R1403:Klb UTSW 5 65348746 missense possibly damaging 0.70
R1403:Klb UTSW 5 65348746 missense possibly damaging 0.70
R1446:Klb UTSW 5 65348995 missense probably damaging 1.00
R1696:Klb UTSW 5 65348746 missense possibly damaging 0.70
R1743:Klb UTSW 5 65375861 missense probably damaging 0.99
R1801:Klb UTSW 5 65349235 missense probably null 0.90
R1804:Klb UTSW 5 65379853 missense probably damaging 1.00
R1848:Klb UTSW 5 65348837 missense probably benign 0.02
R1967:Klb UTSW 5 65372074 missense probably damaging 0.98
R3420:Klb UTSW 5 65372142 missense probably damaging 1.00
R4397:Klb UTSW 5 65380039 missense probably damaging 1.00
R4490:Klb UTSW 5 65375794 missense probably benign 0.02
R4491:Klb UTSW 5 65375794 missense probably benign 0.02
R4547:Klb UTSW 5 65379928 missense probably benign 0.00
R4878:Klb UTSW 5 65348490 missense probably damaging 0.99
R5269:Klb UTSW 5 65348797 missense probably damaging 1.00
R5418:Klb UTSW 5 65383470 missense probably benign 0.00
R5453:Klb UTSW 5 65383385 missense probably benign 0.08
R5541:Klb UTSW 5 65379234 missense probably benign 0.27
R5672:Klb UTSW 5 65379949 missense possibly damaging 0.82
R5841:Klb UTSW 5 65379324 nonsense probably null
R6088:Klb UTSW 5 65349013 missense probably benign 0.07
R6807:Klb UTSW 5 65379534 missense probably damaging 1.00
R6955:Klb UTSW 5 65379088 nonsense probably null
R7068:Klb UTSW 5 65379340 missense probably damaging 1.00
R7284:Klb UTSW 5 65383478 missense probably benign 0.01
R7322:Klb UTSW 5 65383364 missense probably benign 0.44
R7366:Klb UTSW 5 65372431 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCCAGCAGTTAGTGGTAAATGAAG -3'
(R):5'- TCAGTGGATCTGTCTGTGCC -3'

Sequencing Primer
(F):5'- GGAATGAATGGATTTTCTTCAGCTC -3'
(R):5'- GATCTGTCTGTGCCGTTGACAC -3'
Posted On2019-09-13