Incidental Mutation 'R0644:Fam46d'
ID57020
Institutional Source Beutler Lab
Gene Symbol Fam46d
Ensembl Gene ENSMUSG00000073007
Gene Namefamily with sequence similarity 46, member D
SynonymsLOC213449
MMRRC Submission 038829-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R0644 (G1)
Quality Score225
Status Not validated
ChromosomeX
Chromosomal Location107792590-107872909 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 107870645 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 111 (F111S)
Ref Sequence ENSEMBL: ENSMUSP00000129483 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101292] [ENSMUST00000143975] [ENSMUST00000144695] [ENSMUST00000167154]
Predicted Effect probably damaging
Transcript: ENSMUST00000101292
AA Change: F111S

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000098850
Gene: ENSMUSG00000073007
AA Change: F111S

DomainStartEndE-ValueType
DUF1693 9 328 6.24e-223 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143975
SMART Domains Protein: ENSMUSP00000122208
Gene: ENSMUSG00000073007

DomainStartEndE-ValueType
Pfam:DUF1693 9 82 5e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144695
Predicted Effect probably damaging
Transcript: ENSMUST00000167154
AA Change: F111S

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000129483
Gene: ENSMUSG00000073007
AA Change: F111S

DomainStartEndE-ValueType
DUF1693 9 328 6.24e-223 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Antibodies against the protein encoded by this gene were found only in plasma from cancer patients. While it may be a target for immunotherapy, the function of this gene is unknown. [provided by RefSeq, Dec 2009]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg4 A T 9: 44,274,699 I625N possibly damaging Het
Accs A G 2: 93,839,229 L282P probably damaging Het
Acsbg1 T A 9: 54,609,826 I568F probably damaging Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Atp5o A T 16: 91,926,484 V73E probably damaging Het
Bcl9 T C 3: 97,210,497 S294G probably benign Het
C2cd5 A T 6: 143,013,224 M1003K probably damaging Het
Col6a5 A G 9: 105,948,324 probably null Het
Dera A T 6: 137,783,048 T165S probably benign Het
Dscr3 A G 16: 94,502,195 L182P probably damaging Het
Elf2 C T 3: 51,308,131 V53M probably damaging Het
Entpd5 A T 12: 84,386,141 F212L probably benign Het
Fndc3c1 T A X: 106,434,962 T761S probably benign Het
Fsip2 A G 2: 82,976,897 T1187A probably benign Het
Golga2 T C 2: 32,297,521 S95P probably damaging Het
Hfm1 A T 5: 106,898,256 probably null Het
Impdh2 G T 9: 108,563,637 V112L possibly damaging Het
Kbtbd3 A T 9: 4,329,868 M81L probably damaging Het
Lactb T C 9: 66,955,890 R481G possibly damaging Het
Nacad C T 11: 6,599,486 C1235Y possibly damaging Het
Olfr1164 T A 2: 88,093,289 M216L probably benign Het
Olfr196 G A 16: 59,167,616 H176Y probably damaging Het
Osbpl6 C T 2: 76,594,840 R878C probably damaging Het
Polr3a G A 14: 24,484,164 P91L probably damaging Het
Rab27a T A 9: 73,095,423 S211R probably benign Het
Scn9a C T 2: 66,533,061 probably null Het
Shank2 T C 7: 144,411,849 S1065P probably benign Het
Tgm4 A T 9: 123,051,458 D308V probably damaging Het
Ythdf3 T C 3: 16,204,892 I412T possibly damaging Het
Zfp831 T C 2: 174,645,863 V777A probably benign Het
Predicted Primers PCR Primer
(F):5'- ATGGAAGGGGCAATTTTCCCACGC -3'
(R):5'- CACCAATGAAATGGTTGTGGAGGTACG -3'

Sequencing Primer
(F):5'- TTCCCACGCTGGAGGTAAAAC -3'
(R):5'- GCTGTTCTGCTACATCAGGAAAATC -3'
Posted On2013-07-11