Incidental Mutation 'R0645:Zdbf2'
ID57022
Institutional Source Beutler Lab
Gene Symbol Zdbf2
Ensembl Gene ENSMUSG00000027520
Gene Namezinc finger, DBF-type containing 2
Synonyms4930431J08Rik, 9330107J05Rik
MMRRC Submission 038830-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R0645 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location63273265-63314576 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 63304950 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 829 (D829E)
Ref Sequence ENSEMBL: ENSMUSP00000109767 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029025] [ENSMUST00000114132]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029025
AA Change: D829E

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000029025
Gene: ENSMUSG00000027520
AA Change: D829E

DomainStartEndE-ValueType
low complexity region 79 99 N/A INTRINSIC
low complexity region 150 164 N/A INTRINSIC
low complexity region 378 405 N/A INTRINSIC
internal_repeat_6 407 565 7.68e-5 PROSPERO
internal_repeat_5 418 768 5.53e-5 PROSPERO
internal_repeat_1 618 873 3.17e-15 PROSPERO
internal_repeat_4 621 885 2.09e-6 PROSPERO
internal_repeat_3 642 886 1.52e-7 PROSPERO
internal_repeat_2 650 912 5.87e-11 PROSPERO
internal_repeat_6 722 891 7.68e-5 PROSPERO
low complexity region 965 982 N/A INTRINSIC
internal_repeat_4 1061 1328 2.09e-6 PROSPERO
internal_repeat_2 1215 1484 5.87e-11 PROSPERO
internal_repeat_3 1287 1507 1.52e-7 PROSPERO
internal_repeat_1 1307 1536 3.17e-15 PROSPERO
internal_repeat_5 1388 1758 5.53e-5 PROSPERO
low complexity region 1767 1778 N/A INTRINSIC
low complexity region 2211 2235 N/A INTRINSIC
low complexity region 2240 2399 N/A INTRINSIC
low complexity region 2402 2420 N/A INTRINSIC
low complexity region 2446 2458 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083151
Predicted Effect possibly damaging
Transcript: ENSMUST00000114132
AA Change: D829E

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000109767
Gene: ENSMUSG00000027520
AA Change: D829E

DomainStartEndE-ValueType
low complexity region 79 99 N/A INTRINSIC
low complexity region 150 164 N/A INTRINSIC
low complexity region 378 405 N/A INTRINSIC
internal_repeat_6 407 565 7.68e-5 PROSPERO
internal_repeat_5 418 768 5.53e-5 PROSPERO
internal_repeat_1 618 873 3.17e-15 PROSPERO
internal_repeat_4 621 885 2.09e-6 PROSPERO
internal_repeat_3 642 886 1.52e-7 PROSPERO
internal_repeat_2 650 912 5.87e-11 PROSPERO
internal_repeat_6 722 891 7.68e-5 PROSPERO
low complexity region 965 982 N/A INTRINSIC
internal_repeat_4 1061 1328 2.09e-6 PROSPERO
internal_repeat_2 1215 1484 5.87e-11 PROSPERO
internal_repeat_3 1287 1507 1.52e-7 PROSPERO
internal_repeat_1 1307 1536 3.17e-15 PROSPERO
internal_repeat_5 1388 1758 5.53e-5 PROSPERO
low complexity region 1767 1778 N/A INTRINSIC
low complexity region 2211 2235 N/A INTRINSIC
low complexity region 2240 2399 N/A INTRINSIC
low complexity region 2402 2420 N/A INTRINSIC
low complexity region 2446 2458 N/A INTRINSIC
Meta Mutation Damage Score 0.11 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 99% (94/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing DBF4-type zinc finger domains. This gene is imprinted and paternally expressed in lymphocytes but is more stochastically expressed in the placenta. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik C T 2: 111,214,583 probably null Het
Adam18 G T 8: 24,672,120 Y46* probably null Het
Adam26b A C 8: 43,520,487 C493G probably damaging Het
Ak5 A T 3: 152,653,615 L182Q probably damaging Het
Akt1s1 T C 7: 44,849,221 probably benign Het
Amhr2 G T 15: 102,446,428 G133C probably damaging Het
Btbd9 A T 17: 30,524,967 L187Q probably damaging Het
Ccdc117 A T 11: 5,534,385 probably benign Het
Ccdc138 A T 10: 58,575,720 I637F probably damaging Het
Ccdc162 A G 10: 41,586,411 probably benign Het
Cdc25b C A 2: 131,191,613 H157Q probably benign Het
Cdon A G 9: 35,477,083 probably null Het
Cdt1 G A 8: 122,572,145 probably benign Het
Cep350 C T 1: 155,940,712 probably null Het
Cfb T C 17: 34,860,016 K831R probably benign Het
Cldn4 C A 5: 134,946,791 probably benign Het
Cntnap5b T C 1: 100,072,042 probably benign Het
Cyp27b1 T G 10: 127,049,098 S77A probably benign Het
Dlc1 T C 8: 36,574,049 D1342G possibly damaging Het
Dlgap4 A G 2: 156,761,879 H887R probably damaging Het
Duox2 A G 2: 122,292,658 I503T probably damaging Het
Elmsan1 G T 12: 84,158,303 N834K possibly damaging Het
Eml4 T C 17: 83,463,493 probably benign Het
Ermap A G 4: 119,185,691 S212P probably benign Het
Esrrg T A 1: 188,043,341 C22S probably benign Het
Evx2 T A 2: 74,657,894 Y194F possibly damaging Het
Fam126a C T 5: 23,979,508 G242D probably damaging Het
Fbn2 T G 18: 58,058,389 D1554A probably damaging Het
Flrt1 G A 19: 7,097,143 probably benign Het
Fndc5 A G 4: 129,139,837 probably benign Het
Frem1 A T 4: 82,989,166 I837N probably damaging Het
Fzd10 G T 5: 128,602,598 A461S possibly damaging Het
Ganab T A 19: 8,911,113 Y511N probably damaging Het
Gbp7 A G 3: 142,538,165 probably null Het
Gm10639 T C 9: 78,299,021 I75T possibly damaging Het
Gm5919 T A 9: 83,883,383 C91S unknown Het
Gm597 T A 1: 28,776,930 N674Y probably damaging Het
Gpr31b A T 17: 13,052,206 C25* probably null Het
Grb10 A G 11: 11,936,755 S505P probably damaging Het
Grm4 A T 17: 27,435,209 V542E probably damaging Het
Hivep3 G A 4: 120,097,334 R949H possibly damaging Het
Invs A T 4: 48,407,653 M543L probably benign Het
Kcnk2 T C 1: 189,256,730 probably null Het
Kdm6b A T 11: 69,405,018 S808T unknown Het
Klhl30 C T 1: 91,355,506 R277W probably damaging Het
Lama1 A G 17: 67,773,712 Q1245R probably benign Het
Lingo3 G T 10: 80,835,335 H254N probably benign Het
Lzts1 A T 8: 69,135,740 H521Q possibly damaging Het
Map3k19 A C 1: 127,822,182 I1144S possibly damaging Het
Mast2 A G 4: 116,307,987 S1411P probably damaging Het
Mast2 T C 4: 116,312,846 probably benign Het
Mesp1 G T 7: 79,792,580 S225R possibly damaging Het
Micu1 A G 10: 59,839,681 T366A possibly damaging Het
Mknk2 T C 10: 80,671,908 probably null Het
Msh5 A G 17: 35,039,223 L309P probably damaging Het
Myo7b T C 18: 31,994,909 I577V probably benign Het
Myom2 T A 8: 15,117,698 D1094E probably damaging Het
Nedd1 T C 10: 92,691,831 probably null Het
Neu4 T C 1: 94,022,469 L50S probably damaging Het
Noa1 T C 5: 77,309,875 Y61C probably benign Het
Nr1h4 A T 10: 89,506,528 M30K probably benign Het
Nsd3 A G 8: 25,709,069 I1219V probably benign Het
Nup188 T A 2: 30,343,466 probably null Het
Olfr1039 A G 2: 86,131,034 S210P probably damaging Het
Olfr1123 T A 2: 87,418,268 Y71* probably null Het
Olfr420 A T 1: 174,159,354 T194S probably benign Het
Olfr784 T A 10: 129,388,293 I220N possibly damaging Het
Pbk G A 14: 65,813,796 probably benign Het
Pcnx2 G A 8: 125,760,720 T1848M possibly damaging Het
Pdzd7 C T 19: 45,045,475 G57R possibly damaging Het
Pik3r4 C A 9: 105,669,187 probably benign Het
Plce1 A G 19: 38,777,989 S2153G probably damaging Het
Pphln1 G A 15: 93,420,311 V34M possibly damaging Het
Prrc2a T C 17: 35,156,332 D1114G probably damaging Het
Prss16 T C 13: 22,009,376 probably benign Het
Rtp3 T C 9: 110,987,100 K128E probably damaging Het
Scn3a T A 2: 65,524,850 I241F possibly damaging Het
Setd1a G A 7: 127,787,210 V336I probably damaging Het
Sfpq A G 4: 127,022,969 I320V possibly damaging Het
Skint5 A T 4: 113,763,482 D678E unknown Het
Slc12a9 G A 5: 137,315,376 P774S probably benign Het
Slc25a54 C G 3: 109,112,165 L362V possibly damaging Het
Smarcd1 A G 15: 99,707,386 probably null Het
Suco A T 1: 161,834,114 M916K probably damaging Het
Tiam2 T C 17: 3,514,698 S1404P possibly damaging Het
Topors T C 4: 40,260,333 T984A unknown Het
Trabd2b A T 4: 114,586,570 K308M probably damaging Het
Trmo A T 4: 46,377,083 probably benign Het
Trpc3 A T 3: 36,671,505 D107E probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Uggt2 A C 14: 119,057,598 Y539D probably benign Het
Wwc2 T G 8: 47,900,639 probably benign Het
Other mutations in Zdbf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Zdbf2 APN 1 63306514 missense possibly damaging 0.92
IGL00796:Zdbf2 APN 1 63307205 missense probably benign 0.04
IGL00801:Zdbf2 APN 1 63303038 missense possibly damaging 0.66
IGL02803:Zdbf2 APN 1 63303077 missense possibly damaging 0.46
R0143:Zdbf2 UTSW 1 63308074 missense probably benign 0.01
R0147:Zdbf2 UTSW 1 63304006 nonsense probably null
R0148:Zdbf2 UTSW 1 63304006 nonsense probably null
R0433:Zdbf2 UTSW 1 63306143 missense possibly damaging 0.46
R0502:Zdbf2 UTSW 1 63305290 missense possibly damaging 0.66
R0765:Zdbf2 UTSW 1 63305723 missense possibly damaging 0.46
R1068:Zdbf2 UTSW 1 63303430 missense possibly damaging 0.94
R1216:Zdbf2 UTSW 1 63303002 missense possibly damaging 0.83
R1235:Zdbf2 UTSW 1 63309073 missense possibly damaging 0.66
R1352:Zdbf2 UTSW 1 63303053 missense probably damaging 0.96
R1402:Zdbf2 UTSW 1 63303627 missense possibly damaging 0.46
R1402:Zdbf2 UTSW 1 63303627 missense possibly damaging 0.46
R1435:Zdbf2 UTSW 1 63303040 missense possibly damaging 0.66
R1562:Zdbf2 UTSW 1 63303588 missense possibly damaging 0.83
R1624:Zdbf2 UTSW 1 63303859 missense possibly damaging 0.66
R1635:Zdbf2 UTSW 1 63304334 missense possibly damaging 0.92
R1644:Zdbf2 UTSW 1 63308972 missense possibly damaging 0.66
R1662:Zdbf2 UTSW 1 63304249 nonsense probably null
R1700:Zdbf2 UTSW 1 63302741 missense unknown
R1720:Zdbf2 UTSW 1 63303277 missense possibly damaging 0.46
R1853:Zdbf2 UTSW 1 63305542 frame shift probably null
R1854:Zdbf2 UTSW 1 63305542 frame shift probably null
R1973:Zdbf2 UTSW 1 63309701 missense unknown
R2336:Zdbf2 UTSW 1 63303464 missense probably benign 0.00
R2428:Zdbf2 UTSW 1 63305615 missense probably benign 0.04
R3010:Zdbf2 UTSW 1 63303065 missense possibly damaging 0.92
R3034:Zdbf2 UTSW 1 63304205 missense probably damaging 0.96
R3079:Zdbf2 UTSW 1 63307477 missense probably benign 0.05
R3196:Zdbf2 UTSW 1 63308420 missense possibly damaging 0.46
R3711:Zdbf2 UTSW 1 63308671 missense possibly damaging 0.83
R3845:Zdbf2 UTSW 1 63308324 missense possibly damaging 0.66
R4093:Zdbf2 UTSW 1 63309781 missense possibly damaging 0.83
R4250:Zdbf2 UTSW 1 63302861 missense possibly damaging 0.46
R4592:Zdbf2 UTSW 1 63306591 missense possibly damaging 0.82
R4721:Zdbf2 UTSW 1 63308792 missense possibly damaging 0.46
R4779:Zdbf2 UTSW 1 63303238 missense possibly damaging 0.66
R4928:Zdbf2 UTSW 1 63308814 missense possibly damaging 0.81
R4943:Zdbf2 UTSW 1 63302914 missense possibly damaging 0.92
R5025:Zdbf2 UTSW 1 63303650 missense possibly damaging 0.82
R5095:Zdbf2 UTSW 1 63309073 missense possibly damaging 0.66
R5149:Zdbf2 UTSW 1 63304903 missense possibly damaging 0.83
R5326:Zdbf2 UTSW 1 63304411 missense possibly damaging 0.66
R5341:Zdbf2 UTSW 1 63307933 missense probably benign 0.27
R5511:Zdbf2 UTSW 1 63305677 missense probably benign 0.03
R5809:Zdbf2 UTSW 1 63305876 missense possibly damaging 0.90
R5902:Zdbf2 UTSW 1 63306526 missense possibly damaging 0.83
R6162:Zdbf2 UTSW 1 63280818 start gained probably benign
R6245:Zdbf2 UTSW 1 63304433 missense possibly damaging 0.46
R6332:Zdbf2 UTSW 1 63307822 missense possibly damaging 0.66
R6361:Zdbf2 UTSW 1 63303321 missense possibly damaging 0.66
R6489:Zdbf2 UTSW 1 63307478 missense possibly damaging 0.46
R6517:Zdbf2 UTSW 1 63305520 missense possibly damaging 0.81
R6624:Zdbf2 UTSW 1 63303914 missense possibly damaging 0.46
R6643:Zdbf2 UTSW 1 63304508 missense possibly damaging 0.82
R6786:Zdbf2 UTSW 1 63304520 missense possibly damaging 0.46
R6808:Zdbf2 UTSW 1 63308528 missense possibly damaging 0.66
R6896:Zdbf2 UTSW 1 63308872 missense probably damaging 0.98
R6997:Zdbf2 UTSW 1 63290766 missense probably benign 0.09
R7011:Zdbf2 UTSW 1 63306766 missense possibly damaging 0.66
R7058:Zdbf2 UTSW 1 63307404 missense possibly damaging 0.66
R7066:Zdbf2 UTSW 1 63307559 missense probably benign
R7177:Zdbf2 UTSW 1 63294961 missense possibly damaging 0.94
R7184:Zdbf2 UTSW 1 63306505 missense possibly damaging 0.92
R7273:Zdbf2 UTSW 1 63303404 missense possibly damaging 0.90
X0018:Zdbf2 UTSW 1 63305351 missense possibly damaging 0.92
X0027:Zdbf2 UTSW 1 63308007 nonsense probably null
X0057:Zdbf2 UTSW 1 63305390 missense possibly damaging 0.66
X0063:Zdbf2 UTSW 1 63305537 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TCTGTCAGTTACTGAGCGGTCTCTG -3'
(R):5'- AGGTTCTGTCACTGGGTGAGAAGC -3'

Sequencing Primer
(F):5'- CCTGGAAGATGAAAACTGTGTGTC -3'
(R):5'- TGGGATCTTCAGAACATCCG -3'
Posted On2013-07-11